Incidental Mutation 'RF023:Dnmt1'
ID603995
Institutional Source Beutler Lab
Gene Symbol Dnmt1
Ensembl Gene ENSMUSG00000004099
Gene NameDNA methyltransferase (cytosine-5) 1
SynonymsMTase, Dnmt1o, Cxxc9, MommeD2
Accession Numbers

Genbank: NM_010066

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF023 (G1)
Quality Score217.468
Status Not validated
Chromosome9
Chromosomal Location20907209-20959888 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) AGTTCCTACCTCGTT to AGTTCCTACCTCGTTTTGGGGGCGGAGCACCGTTCCTACCTCGTT at 20910131 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004202] [ENSMUST00000177754] [ENSMUST00000178110] [ENSMUST00000216540]
Predicted Effect probably null
Transcript: ENSMUST00000004202
SMART Domains Protein: ENSMUSP00000004202
Gene: ENSMUSG00000004099

DomainStartEndE-ValueType
DMAP_binding 16 106 1.7e-13 SMART
low complexity region 121 143 N/A INTRINSIC
low complexity region 156 166 N/A INTRINSIC
low complexity region 180 194 N/A INTRINSIC
low complexity region 273 290 N/A INTRINSIC
low complexity region 306 328 N/A INTRINSIC
Pfam:DNMT1-RFD 405 540 4.8e-46 PFAM
low complexity region 610 625 N/A INTRINSIC
Pfam:zf-CXXC 648 694 2.7e-17 PFAM
low complexity region 701 711 N/A INTRINSIC
low complexity region 719 731 N/A INTRINSIC
BAH 758 884 4.62e-31 SMART
BAH 935 1103 1.79e-37 SMART
low complexity region 1110 1124 N/A INTRINSIC
Pfam:DNA_methylase 1142 1596 1.3e-49 PFAM
low complexity region 1600 1619 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000177754
SMART Domains Protein: ENSMUSP00000136982
Gene: ENSMUSG00000004099

DomainStartEndE-ValueType
low complexity region 3 25 N/A INTRINSIC
low complexity region 37 47 N/A INTRINSIC
low complexity region 61 75 N/A INTRINSIC
low complexity region 154 171 N/A INTRINSIC
low complexity region 187 209 N/A INTRINSIC
Pfam:DNMT1-RFD 286 421 3.4e-40 PFAM
low complexity region 491 506 N/A INTRINSIC
Pfam:zf-CXXC 529 575 2.3e-17 PFAM
low complexity region 582 592 N/A INTRINSIC
low complexity region 600 612 N/A INTRINSIC
BAH 639 765 4.62e-31 SMART
BAH 816 984 1.79e-37 SMART
low complexity region 991 1005 N/A INTRINSIC
Pfam:DNA_methylase 1023 1477 1.3e-49 PFAM
low complexity region 1481 1500 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000178110
SMART Domains Protein: ENSMUSP00000136669
Gene: ENSMUSG00000004099

DomainStartEndE-ValueType
low complexity region 3 25 N/A INTRINSIC
low complexity region 38 48 N/A INTRINSIC
low complexity region 62 76 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
Pfam:DNMT1-RFD 287 422 2.6e-40 PFAM
low complexity region 492 507 N/A INTRINSIC
Pfam:zf-CXXC 530 576 4.7e-17 PFAM
low complexity region 583 593 N/A INTRINSIC
low complexity region 601 613 N/A INTRINSIC
BAH 640 766 4.62e-31 SMART
BAH 817 985 1.79e-37 SMART
low complexity region 992 1006 N/A INTRINSIC
Pfam:DNA_methylase 1024 1478 8e-50 PFAM
low complexity region 1482 1501 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000216540
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency 96% (24/25)
MGI Phenotype FUNCTION: This gene encodes a methyltransferase that preferentially methylates cytosines of CpG residues in hemimethylated DNA to generate fully methylated CpG base pairs during DNA replication. This enzyme plays roles in diverse cellular processes including cell cycle regulation, DNA repair, and telomere maintenance. The encoded protein is composed of an N-terminal domain with a nuclear localization sequence and replication fork-targeting domain, a DNA-binding CXXC domain, two bromo-adjacent homology domains, and a C-terminal catalytic domain. Mouse embryonic stem cells mutant for this gene are viable, but when introduced into the germ line, cause a recessive lethal phenotype with mutant embryos displaying stunted growth and developmental defects. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mutations causing partial or severe loss of function were homozygous lethal by embryonic day 9.5, with lack of appropriate genomic imprinting observed at several loci. [provided by MGI curators]
Allele List at MGI

All alleles(109) : Targeted, knock-out(5) Targeted, other(11) Gene trapped(92) Chemically induced(1)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T TTATTATTATTATTAG 3: 37,050,760 probably benign Het
5430401F13Rik ACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG ACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,855 probably benign Het
5430401F13Rik AAAAACAGAAAGGAAAAGGTGGCCAG AAAAACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,878 probably benign Het
A030005L19Rik TTGCTGTGGCTGTGGAGGTTGTGGCGGCTGTGGCTGTGG TGGCTGTGGCTGTGG 1: 82,913,396 probably benign Het
Amot GCAACAGCAAC GC X: 145,451,003 probably benign Het
Anks1b G A 10: 90,033,225 G49D probably damaging Het
Arhgef5 T A 6: 43,279,473 S1172T probably damaging Het
Cacna2d4 G A 6: 119,268,230 V300I probably benign Het
Calhm1 GTGGC GTGGCTGTGGCTTTGGC 19: 47,141,273 probably benign Het
Camk2b T C 11: 5,972,301 T516A probably damaging Het
Ccdc170 CCA CCAACA 10: 4,561,018 probably benign Het
Cdhr3 G T 12: 33,060,349 S312Y probably damaging Het
Cdk1 C T 10: 69,340,498 G260S possibly damaging Het
Cdsn AG AGACAGGAAGTAGTAGCTCTCAG 17: 35,554,979 probably benign Het
Cenpp A T 13: 49,650,144 V88E probably benign Het
Cfap46 TCTTCTCCCTCTCCTTCTCCTTCTCCTTCTCC TCTTCTCCTTCTCCTTCTCC 7: 139,638,918 Het
Dnah11 T A 12: 117,954,850 R3449W probably damaging Het
E4f1 AGGC AGGCGGC 17: 24,455,183 probably benign Het
Efhd2 CCGCCG CCGCCGGCGCCG 4: 141,874,762 probably benign Het
Entpd2 CTT CTTT 2: 25,400,895 probably null Het
Ephx2 A G 14: 66,084,929 probably null Het
Exd2 GCAGCAGCCGCAGCCACAGC GCAGC 12: 80,475,915 probably benign Het
Gabre GCTC GCTCCGTCTC X: 72,270,054 probably benign Het
H13 G A 2: 152,669,669 E30K probably damaging Het
Herc1 G C 9: 66,458,334 G324R Het
Hsdl2 CAGCCACAGCTGCAG CAGCCACAGCTGCAGCAGGAGCCACAGCTGCAG 4: 59,610,644 probably benign Het
Il2 GCTTGAAG GCTTGAAGCGGGCCTTGAAG 3: 37,125,820 probably benign Het
Krtap28-10 CAG CAGCCCTAG 1: 83,042,146 probably null Het
Krtap28-10 ACAGC ACAGCCACGGCCACCGCAGC 1: 83,042,286 probably benign Het
Krtap4-9 GGCCCAGCTGCTGTGTGTCCAGCTGCTGCAG GGCCCAGCTGCTGTGTGTCCAGCTGCTGCAGGCCCAGCTGCTGTGTGTCCAGCTGCTGCAG 11: 99,785,391 probably benign Het
Lce1m TGCTGCC TGCTGCCCCCGCCGCTGCC 3: 93,018,280 probably benign Het
Lrch1 TGGTGGTG T 14: 74,947,566 probably null Het
Mgam C T 6: 40,680,708 T999I probably benign Het
Mkl1 T C 15: 81,015,856 E740G probably damaging Het
Nek1 A G 8: 61,072,745 probably null Het
Phactr2 T A 10: 13,245,434 Q503H probably benign Het
Ptprd T C 4: 76,128,565 Y241C probably damaging Het
Rad51ap2 T G 12: 11,458,075 V666G possibly damaging Het
Reep1 CC CCCGAC 6: 71,707,968 probably null Het
Rfx4 CTCTCTCTCT CTCTCTCTCTCTCTCTCTGTCTCTCTCT 10: 84,858,485 probably benign Het
Rnf126 AGGACGAGG AG 10: 79,759,143 probably null Het
Rnpc3 A T 3: 113,620,074 S240T probably damaging Het
Rtbdn GCAGCG GCAGCGTCAGCG 8: 84,956,166 probably benign Het
Sec31b G T 19: 44,535,787 A138D probably damaging Het
Syne1 A T 10: 5,255,482 W3495R probably damaging Het
Tgoln1 CC CCCGTGGGCTTGCCAGAATTACCTTC 6: 72,616,080 probably benign Het
Tmtc3 T C 10: 100,477,866 H48R probably benign Het
Trappc9 CTGCTGCT CTGCTGCTGCTGCTGATGCTGCT 15: 72,801,324 probably benign Het
Trappc9 T TGCTGCTGCTGCTGCC 15: 72,801,331 probably benign Het
Vsig2 T A 9: 37,539,263 probably null Het
Wnk2 T C 13: 49,146,779 T152A probably benign Het
Other mutations in Dnmt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Dnmt1 APN 9 20910270 missense possibly damaging 0.94
IGL01093:Dnmt1 APN 9 20909785 missense possibly damaging 0.88
IGL01160:Dnmt1 APN 9 20917319 missense possibly damaging 0.90
IGL01704:Dnmt1 APN 9 20910180 missense probably damaging 1.00
IGL02105:Dnmt1 APN 9 20907882 missense unknown
IGL02124:Dnmt1 APN 9 20908549 missense probably damaging 1.00
IGL02188:Dnmt1 APN 9 20941738 nonsense probably null
IGL02409:Dnmt1 APN 9 20926497 missense probably benign 0.00
IGL02579:Dnmt1 APN 9 20918120 missense possibly damaging 0.79
IGL02625:Dnmt1 APN 9 20927146 missense probably benign 0.01
IGL02794:Dnmt1 APN 9 20936551 missense probably benign
IGL02795:Dnmt1 APN 9 20927111 missense probably benign 0.12
IGL02938:Dnmt1 APN 9 20941373 missense probably benign 0.23
IGL03245:Dnmt1 APN 9 20915760 missense probably damaging 0.99
IGL03303:Dnmt1 APN 9 20926710 missense probably benign
Blankslate UTSW 9 20912225 missense possibly damaging 0.86
B5639:Dnmt1 UTSW 9 20907968 splice site probably benign
BB003:Dnmt1 UTSW 9 20907559 missense unknown
BB013:Dnmt1 UTSW 9 20907559 missense unknown
PIT4576001:Dnmt1 UTSW 9 20911775 missense probably benign 0.28
R0071:Dnmt1 UTSW 9 20908620 missense probably damaging 0.99
R0180:Dnmt1 UTSW 9 20908620 missense probably damaging 0.99
R0368:Dnmt1 UTSW 9 20941757 missense probably damaging 0.99
R0387:Dnmt1 UTSW 9 20918213 missense probably damaging 1.00
R0529:Dnmt1 UTSW 9 20911550 missense probably damaging 1.00
R0532:Dnmt1 UTSW 9 20918556 splice site probably benign
R0612:Dnmt1 UTSW 9 20918193 missense probably damaging 0.98
R1109:Dnmt1 UTSW 9 20922388 missense probably damaging 1.00
R1298:Dnmt1 UTSW 9 20941456 missense probably benign
R1345:Dnmt1 UTSW 9 20908518 missense probably damaging 1.00
R1472:Dnmt1 UTSW 9 20932176 missense probably benign 0.28
R1654:Dnmt1 UTSW 9 20936574 missense possibly damaging 0.75
R1817:Dnmt1 UTSW 9 20927126 missense probably benign
R1836:Dnmt1 UTSW 9 20918246 missense probably damaging 1.00
R1957:Dnmt1 UTSW 9 20927146 missense probably benign 0.01
R1958:Dnmt1 UTSW 9 20927146 missense probably benign 0.01
R2097:Dnmt1 UTSW 9 20909788 missense probably benign 0.00
R2145:Dnmt1 UTSW 9 20937155 splice site probably benign
R2326:Dnmt1 UTSW 9 20924146 splice site probably benign
R4199:Dnmt1 UTSW 9 20938118 missense probably benign 0.00
R4456:Dnmt1 UTSW 9 20909842 missense probably damaging 1.00
R4518:Dnmt1 UTSW 9 20911978 missense probably benign 0.00
R4586:Dnmt1 UTSW 9 20926693 missense probably benign 0.05
R4836:Dnmt1 UTSW 9 20908558 missense probably damaging 1.00
R5014:Dnmt1 UTSW 9 20912254 missense probably benign 0.07
R5338:Dnmt1 UTSW 9 20952719 missense probably benign 0.44
R5385:Dnmt1 UTSW 9 20918480 missense probably damaging 1.00
R5579:Dnmt1 UTSW 9 20920205 missense probably damaging 1.00
R5645:Dnmt1 UTSW 9 20922147 missense probably damaging 1.00
R5719:Dnmt1 UTSW 9 20912595 missense possibly damaging 0.86
R5881:Dnmt1 UTSW 9 20952717 missense probably damaging 0.97
R6039:Dnmt1 UTSW 9 20926420 intron probably benign
R6039:Dnmt1 UTSW 9 20926420 intron probably benign
R6143:Dnmt1 UTSW 9 20927134 missense probably benign 0.30
R6342:Dnmt1 UTSW 9 20909793 nonsense probably null
R6374:Dnmt1 UTSW 9 20924045 missense possibly damaging 0.73
R6953:Dnmt1 UTSW 9 20918526 missense probably benign
R6990:Dnmt1 UTSW 9 20915814 nonsense probably null
R7089:Dnmt1 UTSW 9 20908489 missense probably damaging 0.99
R7463:Dnmt1 UTSW 9 20912225 missense possibly damaging 0.86
R7522:Dnmt1 UTSW 9 20920202 missense probably damaging 0.99
R7695:Dnmt1 UTSW 9 20913985 missense probably null 1.00
R7785:Dnmt1 UTSW 9 20922049 missense probably damaging 0.98
R7926:Dnmt1 UTSW 9 20907559 missense unknown
R8037:Dnmt1 UTSW 9 20941564 missense probably damaging 0.99
R8038:Dnmt1 UTSW 9 20941564 missense probably damaging 0.99
R8424:Dnmt1 UTSW 9 20918540 missense probably benign 0.07
R8692:Dnmt1 UTSW 9 20941781 missense probably damaging 1.00
RF003:Dnmt1 UTSW 9 20910131 nonsense probably null
RF004:Dnmt1 UTSW 9 20910127 nonsense probably null
RF011:Dnmt1 UTSW 9 20910128 nonsense probably null
RF011:Dnmt1 UTSW 9 20910144 nonsense probably null
RF015:Dnmt1 UTSW 9 20910124 nonsense probably null
RF015:Dnmt1 UTSW 9 20910129 nonsense probably null
RF017:Dnmt1 UTSW 9 20910126 nonsense probably null
RF024:Dnmt1 UTSW 9 20910130 nonsense probably null
RF024:Dnmt1 UTSW 9 20910138 small insertion probably benign
RF025:Dnmt1 UTSW 9 20910120 nonsense probably null
RF025:Dnmt1 UTSW 9 20910135 nonsense probably null
RF029:Dnmt1 UTSW 9 20910123 nonsense probably null
RF034:Dnmt1 UTSW 9 20910120 nonsense probably null
RF037:Dnmt1 UTSW 9 20910119 critical splice donor site probably benign
RF037:Dnmt1 UTSW 9 20910133 nonsense probably null
RF037:Dnmt1 UTSW 9 20910141 nonsense probably null
RF042:Dnmt1 UTSW 9 20910119 nonsense probably null
RF045:Dnmt1 UTSW 9 20910129 nonsense probably null
RF045:Dnmt1 UTSW 9 20910137 small insertion probably benign
RF047:Dnmt1 UTSW 9 20910125 nonsense probably null
RF048:Dnmt1 UTSW 9 20910126 nonsense probably null
RF054:Dnmt1 UTSW 9 20910139 nonsense probably null
RF055:Dnmt1 UTSW 9 20910128 nonsense probably null
RF055:Dnmt1 UTSW 9 20910135 nonsense probably null
RF055:Dnmt1 UTSW 9 20910136 small insertion probably benign
RF059:Dnmt1 UTSW 9 20910138 small insertion probably benign
RF059:Dnmt1 UTSW 9 20910139 nonsense probably null
RF060:Dnmt1 UTSW 9 20910142 nonsense probably null
RF061:Dnmt1 UTSW 9 20910130 nonsense probably null
X0026:Dnmt1 UTSW 9 20913914 missense probably damaging 1.00
Z1176:Dnmt1 UTSW 9 20915863 missense probably damaging 0.99
Z1176:Dnmt1 UTSW 9 20926554 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCTCTGCTGGAACTTAGGAAG -3'
(R):5'- GGGCAGACACTCTACCTAAAGC -3'

Sequencing Primer
(F):5'- CTCTGCTGGAACTTAGGAAGTGAGG -3'
(R):5'- CTTCCTCTGGTGCAGGCTG -3'
Posted On2019-12-04