Incidental Mutation 'RF023:Ccdc170'
ID 603997
Institutional Source Beutler Lab
Gene Symbol Ccdc170
Ensembl Gene ENSMUSG00000019767
Gene Name coiled-coil domain containing 170
Synonyms Gm221, LOC237250
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.327) question?
Stock # RF023 (G1)
Quality Score 211.468
Status Not validated
Chromosome 10
Chromosomal Location 4482502-4562231 bp(+) (GRCm38)
Type of Mutation small insertion (1 aa in frame mutation)
DNA Base Change (assembly) CCA to CCAACA at 4561018 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019901] [ENSMUST00000138112]
AlphaFold D3YXL0
Predicted Effect probably benign
Transcript: ENSMUST00000019901
SMART Domains Protein: ENSMUSP00000019901
Gene: ENSMUSG00000019767

coiled coil region 40 160 N/A INTRINSIC
coiled coil region 264 302 N/A INTRINSIC
low complexity region 345 357 N/A INTRINSIC
coiled coil region 379 415 N/A INTRINSIC
coiled coil region 475 649 N/A INTRINSIC
low complexity region 678 690 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138112
SMART Domains Protein: ENSMUSP00000115997
Gene: ENSMUSG00000019767

low complexity region 2 23 N/A INTRINSIC
internal_repeat_1 80 93 6.25e-5 PROSPERO
internal_repeat_1 305 318 6.25e-5 PROSPERO
low complexity region 351 363 N/A INTRINSIC
coiled coil region 385 421 N/A INTRINSIC
coiled coil region 481 655 N/A INTRINSIC
low complexity region 684 696 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency 96% (24/25)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The function of this gene and its encoded protein is not known. Several genome-wide association studies have implicated the region around this gene to be involved in breast cancer and bone mineral density, but no link to this specific gene has been found. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T TTATTATTATTATTAG 3: 37,050,760 probably benign Het
Amot GCAACAGCAAC GC X: 145,451,003 probably benign Het
Anks1b G A 10: 90,033,225 G49D probably damaging Het
Arhgef5 T A 6: 43,279,473 S1172T probably damaging Het
Cacna2d4 G A 6: 119,268,230 V300I probably benign Het
Calhm1 GTGGC GTGGCTGTGGCTTTGGC 19: 47,141,273 probably benign Het
Camk2b T C 11: 5,972,301 T516A probably damaging Het
Cdhr3 G T 12: 33,060,349 S312Y probably damaging Het
Cdk1 C T 10: 69,340,498 G260S possibly damaging Het
Cdsn AG AGACAGGAAGTAGTAGCTCTCAG 17: 35,554,979 probably benign Het
Cenpp A T 13: 49,650,144 V88E probably benign Het
Dnah11 T A 12: 117,954,850 R3449W probably damaging Het
E4f1 AGGC AGGCGGC 17: 24,455,183 probably benign Het
Efhd2 CCGCCG CCGCCGGCGCCG 4: 141,874,762 probably benign Het
Entpd2 CTT CTTT 2: 25,400,895 probably null Het
Ephx2 A G 14: 66,084,929 probably null Het
Exd2 GCAGCAGCCGCAGCCACAGC GCAGC 12: 80,475,915 probably benign Het
Gabre GCTC GCTCCGTCTC X: 72,270,054 probably benign Het
H13 G A 2: 152,669,669 E30K probably damaging Het
Herc1 G C 9: 66,458,334 G324R Het
Il2 GCTTGAAG GCTTGAAGCGGGCCTTGAAG 3: 37,125,820 probably benign Het
Krtap28-10 CAG CAGCCCTAG 1: 83,042,146 probably null Het
Krtap28-10 ACAGC ACAGCCACGGCCACCGCAGC 1: 83,042,286 probably benign Het
Lce1m TGCTGCC TGCTGCCCCCGCCGCTGCC 3: 93,018,280 probably benign Het
Lrch1 TGGTGGTG T 14: 74,947,566 probably null Het
Mgam C T 6: 40,680,708 T999I probably benign Het
Mkl1 T C 15: 81,015,856 E740G probably damaging Het
Nek1 A G 8: 61,072,745 probably null Het
Phactr2 T A 10: 13,245,434 Q503H probably benign Het
Ptprd T C 4: 76,128,565 Y241C probably damaging Het
Rad51ap2 T G 12: 11,458,075 V666G possibly damaging Het
Reep1 CC CCCGAC 6: 71,707,968 probably null Het
Rnf126 AGGACGAGG AG 10: 79,759,143 probably null Het
Rnpc3 A T 3: 113,620,074 S240T probably damaging Het
Rtbdn GCAGCG GCAGCGTCAGCG 8: 84,956,166 probably benign Het
Sec31b G T 19: 44,535,787 A138D probably damaging Het
Syne1 A T 10: 5,255,482 W3495R probably damaging Het
Tgoln1 CC CCCGTGGGCTTGCCAGAATTACCTTC 6: 72,616,080 probably benign Het
Tmtc3 T C 10: 100,477,866 H48R probably benign Het
Trappc9 CTGCTGCT CTGCTGCTGCTGCTGATGCTGCT 15: 72,801,324 probably benign Het
Trappc9 T TGCTGCTGCTGCTGCC 15: 72,801,331 probably benign Het
Vsig2 T A 9: 37,539,263 probably null Het
Wnk2 T C 13: 49,146,779 T152A probably benign Het
Other mutations in Ccdc170
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Ccdc170 APN 10 4546836 missense probably damaging 1.00
IGL01018:Ccdc170 APN 10 4512788 missense probably benign
IGL01018:Ccdc170 APN 10 4514155 missense probably benign 0.00
IGL01018:Ccdc170 APN 10 4514114 missense probably benign
IGL01114:Ccdc170 APN 10 4558550 missense probably benign 0.01
IGL01377:Ccdc170 APN 10 4560966 missense probably damaging 1.00
IGL01726:Ccdc170 APN 10 4549713 missense probably benign 0.04
IGL02110:Ccdc170 APN 10 4541885 splice site probably null
FR4304:Ccdc170 UTSW 10 4561021 small insertion probably benign
FR4548:Ccdc170 UTSW 10 4561026 small insertion probably benign
FR4737:Ccdc170 UTSW 10 4561023 small insertion probably benign
FR4737:Ccdc170 UTSW 10 4561029 small insertion probably benign
FR4976:Ccdc170 UTSW 10 4561008 small insertion probably benign
FR4976:Ccdc170 UTSW 10 4561023 small insertion probably benign
FR4976:Ccdc170 UTSW 10 4561029 small insertion probably benign
R0137:Ccdc170 UTSW 10 4546950 splice site probably benign
R0280:Ccdc170 UTSW 10 4558663 missense possibly damaging 0.62
R0480:Ccdc170 UTSW 10 4518939 missense probably benign 0.00
R1786:Ccdc170 UTSW 10 4519043 missense probably benign 0.02
R2383:Ccdc170 UTSW 10 4534208 missense probably benign 0.00
R3031:Ccdc170 UTSW 10 4518931 missense probably damaging 0.99
R3797:Ccdc170 UTSW 10 4560920 missense possibly damaging 0.60
R4494:Ccdc170 UTSW 10 4514128 missense probably damaging 1.00
R4916:Ccdc170 UTSW 10 4518971 missense probably damaging 0.96
R5152:Ccdc170 UTSW 10 4561107 missense probably damaging 1.00
R5170:Ccdc170 UTSW 10 4514200 missense probably damaging 0.99
R5354:Ccdc170 UTSW 10 4534188 missense probably benign 0.16
R5911:Ccdc170 UTSW 10 4558551 nonsense probably null
R5983:Ccdc170 UTSW 10 4520851 nonsense probably null
R6374:Ccdc170 UTSW 10 4549746 nonsense probably null
R6645:Ccdc170 UTSW 10 4560974 missense possibly damaging 0.95
R6818:Ccdc170 UTSW 10 4541782 missense probably damaging 1.00
R6888:Ccdc170 UTSW 10 4546854 missense possibly damaging 0.91
R7032:Ccdc170 UTSW 10 4482597 missense unknown
R7206:Ccdc170 UTSW 10 4514120 missense possibly damaging 0.66
R7393:Ccdc170 UTSW 10 4514314 critical splice donor site probably null
R7438:Ccdc170 UTSW 10 4558512 nonsense probably null
R7471:Ccdc170 UTSW 10 4520803 missense probably benign 0.00
R7514:Ccdc170 UTSW 10 4546839 missense probably benign 0.37
R7818:Ccdc170 UTSW 10 4549603 missense probably benign 0.05
R8942:Ccdc170 UTSW 10 4534044 missense probably benign 0.07
R9069:Ccdc170 UTSW 10 4561016 missense possibly damaging 0.46
R9355:Ccdc170 UTSW 10 4558695 missense probably benign 0.17
RF006:Ccdc170 UTSW 10 4561030 small insertion probably benign
RF009:Ccdc170 UTSW 10 4561030 small insertion probably benign
RF011:Ccdc170 UTSW 10 4561018 small insertion probably benign
RF017:Ccdc170 UTSW 10 4561024 small insertion probably benign
RF024:Ccdc170 UTSW 10 4561024 small insertion probably benign
RF025:Ccdc170 UTSW 10 4561026 small insertion probably benign
RF027:Ccdc170 UTSW 10 4561026 small insertion probably benign
RF029:Ccdc170 UTSW 10 4561026 small insertion probably benign
RF050:Ccdc170 UTSW 10 4561008 small insertion probably benign
RF064:Ccdc170 UTSW 10 4561025 small insertion probably benign
Z1177:Ccdc170 UTSW 10 4509884 missense probably benign
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2019-12-04