Incidental Mutation 'RF023:Camk2b'
ID 604005
Institutional Source Beutler Lab
Gene Symbol Camk2b
Ensembl Gene ENSMUSG00000057897
Gene Name calcium/calmodulin-dependent protein kinase II, beta
Synonyms CaMK II
Accession Numbers
Essential gene? Probably non essential (E-score: 0.169) question?
Stock # RF023 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 5919644-6016362 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 5922301 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 516 (T516A)
Ref Sequence ENSEMBL: ENSMUSP00000105438 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002817] [ENSMUST00000002818] [ENSMUST00000019133] [ENSMUST00000066431] [ENSMUST00000090443] [ENSMUST00000093355] [ENSMUST00000109813] [ENSMUST00000101585] [ENSMUST00000101586] [ENSMUST00000109812] [ENSMUST00000109815]
AlphaFold P28652
Predicted Effect probably damaging
Transcript: ENSMUST00000002817
AA Change: T477A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000002817
Gene: ENSMUSG00000057897
AA Change: T477A

DomainStartEndE-ValueType
S_TKc 14 272 1.37e-103 SMART
Pfam:CaMKII_AD 371 498 5.3e-63 PFAM
Pfam:DUF4440 375 489 2.8e-15 PFAM
Pfam:SnoaL_3 375 500 2.2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000002818
SMART Domains Protein: ENSMUSP00000002818
Gene: ENSMUSG00000002741

DomainStartEndE-ValueType
low complexity region 25 39 N/A INTRINSIC
Longin 43 139 1.36e-21 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000019133
AA Change: T640A

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000019133
Gene: ENSMUSG00000057897
AA Change: T640A

DomainStartEndE-ValueType
S_TKc 14 272 1.37e-103 SMART
low complexity region 320 336 N/A INTRINSIC
low complexity region 436 451 N/A INTRINSIC
low complexity region 468 491 N/A INTRINSIC
low complexity region 511 533 N/A INTRINSIC
Pfam:CaMKII_AD 534 661 3.7e-62 PFAM
Pfam:DUF4440 538 652 1.6e-13 PFAM
Pfam:SnoaL_3 538 663 4.7e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000066431
AA Change: T453A

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000065101
Gene: ENSMUSG00000057897
AA Change: T453A

DomainStartEndE-ValueType
S_TKc 14 272 1.37e-103 SMART
Pfam:CaMKII_AD 347 474 4.8e-63 PFAM
Pfam:DUF4440 351 465 2.6e-15 PFAM
Pfam:SnoaL_3 351 476 2e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000090443
AA Change: T519A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087925
Gene: ENSMUSG00000057897
AA Change: T519A

DomainStartEndE-ValueType
S_TKc 14 272 1.37e-103 SMART
low complexity region 390 412 N/A INTRINSIC
Pfam:CaMKII_AD 413 540 6.1e-63 PFAM
Pfam:DUF4440 417 531 3.2e-15 PFAM
Pfam:SnoaL_3 417 542 2.5e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000093355
AA Change: T563A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091046
Gene: ENSMUSG00000057897
AA Change: T563A

DomainStartEndE-ValueType
S_TKc 14 272 1.37e-103 SMART
internal_repeat_1 373 388 8.07e-7 PROSPERO
low complexity region 391 414 N/A INTRINSIC
internal_repeat_1 416 431 8.07e-7 PROSPERO
low complexity region 434 456 N/A INTRINSIC
Pfam:CaMKII_AD 457 584 5.8e-63 PFAM
Pfam:DUF4440 461 575 6.7e-15 PFAM
Pfam:SnoaL_3 461 586 4.8e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109813
AA Change: T516A

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105438
Gene: ENSMUSG00000057897
AA Change: T516A

DomainStartEndE-ValueType
S_TKc 14 272 1.37e-103 SMART
low complexity region 320 336 N/A INTRINSIC
Pfam:CaMKII_AD 410 537 1.4e-62 PFAM
Pfam:DUF4440 414 528 5.9e-15 PFAM
Pfam:SnoaL_3 414 539 5e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101585
AA Change: T492A

PolyPhen 2 Score 0.289 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000099119
Gene: ENSMUSG00000057897
AA Change: T492A

DomainStartEndE-ValueType
S_TKc 14 272 1.37e-103 SMART
low complexity region 320 336 N/A INTRINSIC
Pfam:CaMKII_AD 386 513 5.6e-63 PFAM
Pfam:DUF4440 390 504 3e-15 PFAM
Pfam:SnoaL_3 390 515 2.3e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000101586
AA Change: T492A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099120
Gene: ENSMUSG00000057897
AA Change: T492A

DomainStartEndE-ValueType
S_TKc 14 272 1.37e-103 SMART
Pfam:CaMKII_AD 386 513 5.6e-63 PFAM
Pfam:DUF4440 390 504 3e-15 PFAM
Pfam:SnoaL_3 390 515 2.3e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109812
AA Change: T503A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105437
Gene: ENSMUSG00000057897
AA Change: T503A

DomainStartEndE-ValueType
S_TKc 14 283 5.98e-95 SMART
Pfam:CaMKII_AD 397 524 5.8e-63 PFAM
Pfam:DUF4440 401 515 3.1e-15 PFAM
Pfam:SnoaL_3 401 526 2.4e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109815
AA Change: T516A

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105440
Gene: ENSMUSG00000057897
AA Change: T516A

DomainStartEndE-ValueType
S_TKc 14 272 1.37e-103 SMART
low complexity region 320 336 N/A INTRINSIC
Pfam:CaMKII_AD 410 537 1.4e-62 PFAM
Pfam:DUF4440 414 528 5.9e-15 PFAM
Pfam:SnoaL_3 414 539 5e-13 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency 96% (24/25)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the serine/threonine protein kinase family and to the Ca(2+)/calmodulin-dependent protein kinase subfamily. Calcium signaling is crucial for several aspects of plasticity at glutamatergic synapses. In mammalian cells, the enzyme is composed of four different chains: alpha, beta, gamma, and delta. The product of this gene is a beta chain. It is possible that distinct isoforms of this chain have different cellular localizations and interact differently with calmodulin. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit reversal of plasticity direction at parallel fiber-Purkinje cell synapses. Mice homozygous for a different null allele show motor impairments, including ataxia, altered body mass composition, a reduction in anxiety-related behavior, and cognitive deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik ACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG ACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,529,818 (GRCm39) probably benign Het
5430401F13Rik AAAAACAGAAAGGAAAAGGTGGCCAG AAAAACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,529,841 (GRCm39) probably benign Het
A030005L19Rik TTGCTGTGGCTGTGGAGGTTGTGGCGGCTGTGGCTGTGG TGGCTGTGGCTGTGG 1: 82,891,117 (GRCm39) probably benign Het
Amot GCAACAGCAAC GC X: 144,233,999 (GRCm39) probably benign Het
Anks1b G A 10: 89,869,087 (GRCm39) G49D probably damaging Het
Arhgef5 T A 6: 43,256,407 (GRCm39) S1172T probably damaging Het
Bltp1 T TTATTATTATTATTAG 3: 37,104,909 (GRCm39) probably benign Het
Cacna2d4 G A 6: 119,245,191 (GRCm39) V300I probably benign Het
Calhm1 GTGGC GTGGCTGTGGCTTTGGC 19: 47,129,712 (GRCm39) probably benign Het
Ccdc170 CCA CCAACA 10: 4,511,018 (GRCm39) probably benign Het
Cdhr3 G T 12: 33,110,348 (GRCm39) S312Y probably damaging Het
Cdk1 C T 10: 69,176,328 (GRCm39) G260S possibly damaging Het
Cdsn AG AGACAGGAAGTAGTAGCTCTCAG 17: 35,865,876 (GRCm39) probably benign Het
Cenpp A T 13: 49,803,620 (GRCm39) V88E probably benign Het
Cfap46 TCTTCTCCCTCTCCTTCTCCTTCTCCTTCTCC TCTTCTCCTTCTCCTTCTCC 7: 139,218,834 (GRCm39) Het
Dnah11 T A 12: 117,918,585 (GRCm39) R3449W probably damaging Het
Dnmt1 AGTTCCTACCTCGTT AGTTCCTACCTCGTTTTGGGGGCGGAGCACCGTTCCTACCTCGTT 9: 20,821,427 (GRCm39) probably null Het
E4f1 AGGC AGGCGGC 17: 24,674,157 (GRCm39) probably benign Het
Efhd2 CCGCCG CCGCCGGCGCCG 4: 141,602,073 (GRCm39) probably benign Het
Entpd2 CTT CTTT 2: 25,290,907 (GRCm39) probably null Het
Ephx2 A G 14: 66,322,378 (GRCm39) probably null Het
Exd2 GCAGCAGCCGCAGCCACAGC GCAGC 12: 80,522,689 (GRCm39) probably benign Het
Gabre GCTC GCTCCGTCTC X: 71,313,660 (GRCm39) probably benign Het
H13 G A 2: 152,511,589 (GRCm39) E30K probably damaging Het
Herc1 G C 9: 66,365,616 (GRCm39) G324R Het
Hsdl2 CAGCCACAGCTGCAG CAGCCACAGCTGCAGCAGGAGCCACAGCTGCAG 4: 59,610,644 (GRCm39) probably benign Het
Il2 GCTTGAAG GCTTGAAGCGGGCCTTGAAG 3: 37,179,969 (GRCm39) probably benign Het
Krtap28-10 CAG CAGCCCTAG 1: 83,019,867 (GRCm39) probably null Het
Krtap28-10 ACAGC ACAGCCACGGCCACCGCAGC 1: 83,020,007 (GRCm39) probably benign Het
Krtap4-9 GGCCCAGCTGCTGTGTGTCCAGCTGCTGCAG GGCCCAGCTGCTGTGTGTCCAGCTGCTGCAGGCCCAGCTGCTGTGTGTCCAGCTGCTGCAG 11: 99,676,217 (GRCm39) probably benign Het
Lce1m TGCTGCC TGCTGCCCCCGCCGCTGCC 3: 92,925,587 (GRCm39) probably benign Het
Lrch1 TGGTGGTG T 14: 75,185,006 (GRCm39) probably null Het
Mgam C T 6: 40,657,642 (GRCm39) T999I probably benign Het
Mrtfa T C 15: 80,900,057 (GRCm39) E740G probably damaging Het
Nek1 A G 8: 61,525,779 (GRCm39) probably null Het
Phactr2 T A 10: 13,121,178 (GRCm39) Q503H probably benign Het
Ptprd T C 4: 76,046,802 (GRCm39) Y241C probably damaging Het
Rad51ap2 T G 12: 11,508,076 (GRCm39) V666G possibly damaging Het
Reep1 CC CCCGAC 6: 71,684,952 (GRCm39) probably null Het
Rfx4 CTCTCTCTCT CTCTCTCTCTCTCTCTCTGTCTCTCTCT 10: 84,694,349 (GRCm39) probably benign Het
Rnf126 AGGACGAGG AG 10: 79,594,977 (GRCm39) probably null Het
Rnpc3 A T 3: 113,413,723 (GRCm39) S240T probably damaging Het
Rtbdn GCAGCG GCAGCGTCAGCG 8: 85,682,795 (GRCm39) probably benign Het
Sec31b G T 19: 44,524,226 (GRCm39) A138D probably damaging Het
Syne1 A T 10: 5,205,482 (GRCm39) W3495R probably damaging Het
Tgoln1 CC CCCGTGGGCTTGCCAGAATTACCTTC 6: 72,593,063 (GRCm39) probably benign Het
Tmtc3 T C 10: 100,313,728 (GRCm39) H48R probably benign Het
Trappc9 CTGCTGCT CTGCTGCTGCTGCTGATGCTGCT 15: 72,673,173 (GRCm39) probably benign Het
Trappc9 T TGCTGCTGCTGCTGCC 15: 72,673,180 (GRCm39) probably benign Het
Vsig2 T A 9: 37,450,559 (GRCm39) probably null Het
Wnk2 T C 13: 49,300,255 (GRCm39) T152A probably benign Het
Other mutations in Camk2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Camk2b APN 11 5,922,310 (GRCm39) missense probably damaging 1.00
IGL01821:Camk2b APN 11 5,947,890 (GRCm39) missense possibly damaging 0.92
IGL02219:Camk2b APN 11 5,926,872 (GRCm39) missense possibly damaging 0.56
IGL02890:Camk2b APN 11 5,951,340 (GRCm39) missense possibly damaging 0.90
R1645:Camk2b UTSW 11 5,922,719 (GRCm39) missense probably damaging 1.00
R1786:Camk2b UTSW 11 5,927,880 (GRCm39) missense probably benign 0.06
R1836:Camk2b UTSW 11 5,922,384 (GRCm39) missense probably damaging 1.00
R2133:Camk2b UTSW 11 5,927,880 (GRCm39) missense probably benign 0.06
R3828:Camk2b UTSW 11 5,978,932 (GRCm39) missense probably damaging 0.99
R4283:Camk2b UTSW 11 5,937,099 (GRCm39) missense probably benign 0.39
R5919:Camk2b UTSW 11 5,929,718 (GRCm39) missense probably damaging 1.00
R6074:Camk2b UTSW 11 5,939,635 (GRCm39) missense probably damaging 1.00
R6269:Camk2b UTSW 11 5,928,497 (GRCm39) missense probably damaging 1.00
R6595:Camk2b UTSW 11 5,942,856 (GRCm39) missense probably damaging 1.00
R6999:Camk2b UTSW 11 5,922,321 (GRCm39) missense probably damaging 1.00
R7030:Camk2b UTSW 11 5,939,575 (GRCm39) missense probably damaging 1.00
R7396:Camk2b UTSW 11 5,928,432 (GRCm39) missense probably benign
R7798:Camk2b UTSW 11 5,928,399 (GRCm39) missense probably benign 0.08
R7818:Camk2b UTSW 11 5,927,812 (GRCm39) missense probably benign
R8342:Camk2b UTSW 11 5,940,383 (GRCm39) missense probably benign 0.21
R8388:Camk2b UTSW 11 5,939,026 (GRCm39) missense probably damaging 1.00
R8850:Camk2b UTSW 11 5,922,838 (GRCm39) missense probably damaging 1.00
R9180:Camk2b UTSW 11 5,939,332 (GRCm39) nonsense probably null
R9319:Camk2b UTSW 11 5,927,814 (GRCm39) missense probably benign
R9493:Camk2b UTSW 11 5,929,711 (GRCm39) missense probably damaging 1.00
R9725:Camk2b UTSW 11 5,922,634 (GRCm39) missense possibly damaging 0.83
R9800:Camk2b UTSW 11 5,922,408 (GRCm39) missense probably damaging 0.97
Z1176:Camk2b UTSW 11 5,927,940 (GRCm39) missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- ACGACCAACTCCATTGCTG -3'
(R):5'- AAGCCTGCTTGTTCACAGTG -3'

Sequencing Primer
(F):5'- ATTGCTGACCCGCCAAG -3'
(R):5'- GTTCACAGTGCTGGCCAAGAAC -3'
Posted On 2019-12-04