Incidental Mutation 'RF023:Cdhr3'
ID604008
Institutional Source Beutler Lab
Gene Symbol Cdhr3
Ensembl Gene ENSMUSG00000035860
Gene Namecadherin-related family member 3
Synonyms1110049B09Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #RF023 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location33033796-33092875 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 33060349 bp
ZygosityHeterozygous
Amino Acid Change Serine to Tyrosine at position 312 (S312Y)
Ref Sequence ENSEMBL: ENSMUSP00000093449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095774]
Predicted Effect probably damaging
Transcript: ENSMUST00000095774
AA Change: S312Y

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000093449
Gene: ENSMUSG00000035860
AA Change: S312Y

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
CA 36 131 5.54e-2 SMART
CA 156 234 3.73e-10 SMART
CA 258 343 5.47e-17 SMART
CA 369 459 9.87e-1 SMART
CA 483 564 1.17e-16 SMART
CA 590 683 1.1e0 SMART
transmembrane domain 708 730 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency 96% (24/25)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T TTATTATTATTATTAG 3: 37,050,760 probably benign Het
5430401F13Rik ACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG ACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,855 probably benign Het
5430401F13Rik AAAAACAGAAAGGAAAAGGTGGCCAG AAAAACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,878 probably benign Het
A030005L19Rik TTGCTGTGGCTGTGGAGGTTGTGGCGGCTGTGGCTGTGG TGGCTGTGGCTGTGG 1: 82,913,396 probably benign Het
Amot GCAACAGCAAC GC X: 145,451,003 probably benign Het
Anks1b G A 10: 90,033,225 G49D probably damaging Het
Arhgef5 T A 6: 43,279,473 S1172T probably damaging Het
Cacna2d4 G A 6: 119,268,230 V300I probably benign Het
Calhm1 GTGGC GTGGCTGTGGCTTTGGC 19: 47,141,273 probably benign Het
Camk2b T C 11: 5,972,301 T516A probably damaging Het
Ccdc170 CCA CCAACA 10: 4,561,018 probably benign Het
Cdk1 C T 10: 69,340,498 G260S possibly damaging Het
Cdsn AG AGACAGGAAGTAGTAGCTCTCAG 17: 35,554,979 probably benign Het
Cenpp A T 13: 49,650,144 V88E probably benign Het
Cfap46 TCTTCTCCCTCTCCTTCTCCTTCTCCTTCTCC TCTTCTCCTTCTCCTTCTCC 7: 139,638,918 Het
Dnah11 T A 12: 117,954,850 R3449W probably damaging Het
Dnmt1 AGTTCCTACCTCGTT AGTTCCTACCTCGTTTTGGGGGCGGAGCACCGTTCCTACCTCGTT 9: 20,910,131 probably null Het
E4f1 AGGC AGGCGGC 17: 24,455,183 probably benign Het
Efhd2 CCGCCG CCGCCGGCGCCG 4: 141,874,762 probably benign Het
Entpd2 CTT CTTT 2: 25,400,895 probably null Het
Ephx2 A G 14: 66,084,929 probably null Het
Exd2 GCAGCAGCCGCAGCCACAGC GCAGC 12: 80,475,915 probably benign Het
Gabre GCTC GCTCCGTCTC X: 72,270,054 probably benign Het
H13 G A 2: 152,669,669 E30K probably damaging Het
Herc1 G C 9: 66,458,334 G324R Het
Hsdl2 CAGCCACAGCTGCAG CAGCCACAGCTGCAGCAGGAGCCACAGCTGCAG 4: 59,610,644 probably benign Het
Il2 GCTTGAAG GCTTGAAGCGGGCCTTGAAG 3: 37,125,820 probably benign Het
Krtap28-10 CAG CAGCCCTAG 1: 83,042,146 probably null Het
Krtap28-10 ACAGC ACAGCCACGGCCACCGCAGC 1: 83,042,286 probably benign Het
Krtap4-9 GGCCCAGCTGCTGTGTGTCCAGCTGCTGCAG GGCCCAGCTGCTGTGTGTCCAGCTGCTGCAGGCCCAGCTGCTGTGTGTCCAGCTGCTGCAG 11: 99,785,391 probably benign Het
Lce1m TGCTGCC TGCTGCCCCCGCCGCTGCC 3: 93,018,280 probably benign Het
Lrch1 TGGTGGTG T 14: 74,947,566 probably null Het
Mgam C T 6: 40,680,708 T999I probably benign Het
Mkl1 T C 15: 81,015,856 E740G probably damaging Het
Nek1 A G 8: 61,072,745 probably null Het
Phactr2 T A 10: 13,245,434 Q503H probably benign Het
Ptprd T C 4: 76,128,565 Y241C probably damaging Het
Rad51ap2 T G 12: 11,458,075 V666G possibly damaging Het
Reep1 CC CCCGAC 6: 71,707,968 probably null Het
Rfx4 CTCTCTCTCT CTCTCTCTCTCTCTCTCTGTCTCTCTCT 10: 84,858,485 probably benign Het
Rnf126 AGGACGAGG AG 10: 79,759,143 probably null Het
Rnpc3 A T 3: 113,620,074 S240T probably damaging Het
Rtbdn GCAGCG GCAGCGTCAGCG 8: 84,956,166 probably benign Het
Sec31b G T 19: 44,535,787 A138D probably damaging Het
Syne1 A T 10: 5,255,482 W3495R probably damaging Het
Tgoln1 CC CCCGTGGGCTTGCCAGAATTACCTTC 6: 72,616,080 probably benign Het
Tmtc3 T C 10: 100,477,866 H48R probably benign Het
Trappc9 CTGCTGCT CTGCTGCTGCTGCTGATGCTGCT 15: 72,801,324 probably benign Het
Trappc9 T TGCTGCTGCTGCTGCC 15: 72,801,331 probably benign Het
Vsig2 T A 9: 37,539,263 probably null Het
Wnk2 T C 13: 49,146,779 T152A probably benign Het
Other mutations in Cdhr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Cdhr3 APN 12 33052209 missense probably benign 0.00
IGL01508:Cdhr3 APN 12 33053428 missense possibly damaging 0.84
IGL02396:Cdhr3 APN 12 33045196 missense possibly damaging 0.64
IGL02414:Cdhr3 APN 12 33042504 missense possibly damaging 0.76
IGL02450:Cdhr3 APN 12 33082225 missense probably benign
IGL02453:Cdhr3 APN 12 33042503 missense probably damaging 0.97
IGL02567:Cdhr3 APN 12 33038901 missense probably benign 0.02
IGL03342:Cdhr3 APN 12 33051055 missense probably benign 0.14
R0022:Cdhr3 UTSW 12 33082264 missense probably damaging 1.00
R0022:Cdhr3 UTSW 12 33082264 missense probably damaging 1.00
R0133:Cdhr3 UTSW 12 33092752 missense possibly damaging 0.94
R0140:Cdhr3 UTSW 12 33080413 missense probably benign 0.00
R0157:Cdhr3 UTSW 12 33061650 missense possibly damaging 0.52
R0762:Cdhr3 UTSW 12 33060301 missense probably benign 0.01
R1421:Cdhr3 UTSW 12 33060292 missense probably damaging 1.00
R1553:Cdhr3 UTSW 12 33042371 missense probably benign 0.10
R1691:Cdhr3 UTSW 12 33082247 missense probably damaging 0.99
R1822:Cdhr3 UTSW 12 33045205 missense probably null 1.00
R1855:Cdhr3 UTSW 12 33060352 missense probably damaging 1.00
R1897:Cdhr3 UTSW 12 33045193 missense possibly damaging 0.81
R2496:Cdhr3 UTSW 12 33049069 missense probably benign 0.01
R2507:Cdhr3 UTSW 12 33038915 missense probably benign
R3155:Cdhr3 UTSW 12 33049153 missense possibly damaging 0.83
R3906:Cdhr3 UTSW 12 33053428 missense probably damaging 0.97
R4005:Cdhr3 UTSW 12 33080356 missense probably damaging 0.98
R4277:Cdhr3 UTSW 12 33060233 missense probably null 0.16
R4573:Cdhr3 UTSW 12 33068153 splice site probably null
R4752:Cdhr3 UTSW 12 33086103 missense probably damaging 0.99
R5364:Cdhr3 UTSW 12 33051008 missense possibly damaging 0.67
R5562:Cdhr3 UTSW 12 33051055 missense probably benign 0.01
R5564:Cdhr3 UTSW 12 33048986 nonsense probably null
R5768:Cdhr3 UTSW 12 33046686 missense possibly damaging 0.73
R6255:Cdhr3 UTSW 12 33053475 missense probably damaging 1.00
R6821:Cdhr3 UTSW 12 33035045 missense probably damaging 1.00
R6983:Cdhr3 UTSW 12 33042380 missense probably benign 0.32
R7155:Cdhr3 UTSW 12 33061773 missense probably damaging 1.00
R7496:Cdhr3 UTSW 12 33060265 missense probably damaging 1.00
R7736:Cdhr3 UTSW 12 33053520 missense probably benign 0.33
R7788:Cdhr3 UTSW 12 33060320 missense probably damaging 1.00
R8178:Cdhr3 UTSW 12 33048932 splice site probably null
X0024:Cdhr3 UTSW 12 33067236 missense possibly damaging 0.90
X0028:Cdhr3 UTSW 12 33042456 missense probably benign
Z1176:Cdhr3 UTSW 12 33060322 missense probably damaging 1.00
Z1176:Cdhr3 UTSW 12 33080324 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- CACCTCAAATCGGCTTGTAGAG -3'
(R):5'- ACACGACATGTCTGTAGAGGGG -3'

Sequencing Primer
(F):5'- CTTGTAGAGAGTCAGTCCCCAATG -3'
(R):5'- ACATGTCTGTAGAGGGGCTATTCC -3'
Posted On2019-12-04