Mutagenetix > Incidental Mutation

Incidental Mutation 'RF023:Trappc9'

604015

Institutional Source

Beutler Lab

Gene Symbol

Trappc9

Ensembl Gene

ENSMUSG00000047921

Gene Name

trafficking protein particle complex 9

Synonyms

TRS130, Nibp, 2900005P22Rik, 4632408O18Rik, 1810044A24Rik

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

RF023 (G1)

Quality Score

213.468

Status

Not validated

Chromosome

Chromosomal Location

72589620-73061204 bp(-) (GRCm38)

Type of Mutation

small insertion (5 aa in frame mutation)

DNA Base Change (assembly)

CTGCTGCT to CTGCTGCTGCTGCTGATGCTGCT at 72801324 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000131997 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023276] [ENSMUST00000089770] [ENSMUST00000170633]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000023276

SMART Domains

Protein: ENSMUSP00000023276
Gene: ENSMUSG00000047921

Domain	Start	End	E-Value	Type
Pfam:TRAPPC9-Trs120	2	920	3.6e-239	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000089770

SMART Domains

Protein: ENSMUSP00000087202
Gene: ENSMUSG00000047921

Domain	Start	End	E-Value	Type
Pfam:TRAPPC9-Trs120	182	350	4.1e-20	PFAM
Pfam:TRAPPC9-Trs120	434	664	2.2e-16	PFAM
low complexity region	993	1004	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000170633

SMART Domains

Protein: ENSMUSP00000131997
Gene: ENSMUSG00000047921

Domain	Start	End	E-Value	Type
Pfam:TRAPPC9-Trs120	1	820	7.6e-224	PFAM
coiled coil region	857	885	N/A	INTRINSIC
low complexity region	906	929	N/A	INTRINSIC

Coding Region Coverage

1x: 99.8%
3x: 99.7%
10x: 99.4%
20x: 98.7%

Validation Efficiency

96% (24/25)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that likely plays a role in NF-kappa-B signaling. Mutations in this gene have been associated with autosomal-recessive mental retardation. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	T	TTATTATTATTATTAG	3: 37,050,760		probably benign	Het
5430401F13Rik	ACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG	ACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG	6: 131,552,855		probably benign	Het
5430401F13Rik	AAAAACAGAAAGGAAAAGGTGGCCAG	AAAAACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG	6: 131,552,878		probably benign	Het
A030005L19Rik	TTGCTGTGGCTGTGGAGGTTGTGGCGGCTGTGGCTGTGG	TGGCTGTGGCTGTGG	1: 82,913,396		probably benign	Het
Amot	GCAACAGCAAC	GC	X: 145,451,003		probably benign	Het
Anks1b	G	A	10: 90,033,225	G49D	probably damaging	Het
Arhgef5	T	A	6: 43,279,473	S1172T	probably damaging	Het
Cacna2d4	G	A	6: 119,268,230	V300I	probably benign	Het
Calhm1	GTGGC	GTGGCTGTGGCTTTGGC	19: 47,141,273		probably benign	Het
Camk2b	T	C	11: 5,972,301	T516A	probably damaging	Het
Ccdc170	CCA	CCAACA	10: 4,561,018		probably benign	Het
Cdhr3	G	T	12: 33,060,349	S312Y	probably damaging	Het
Cdk1	C	T	10: 69,340,498	G260S	possibly damaging	Het
Cdsn	AG	AGACAGGAAGTAGTAGCTCTCAG	17: 35,554,979		probably benign	Het
Cenpp	A	T	13: 49,650,144	V88E	probably benign	Het
Cfap46	TCTTCTCCCTCTCCTTCTCCTTCTCCTTCTCC	TCTTCTCCTTCTCCTTCTCC	7: 139,638,918			Het
Dnah11	T	A	12: 117,954,850	R3449W	probably damaging	Het
Dnmt1	AGTTCCTACCTCGTT	AGTTCCTACCTCGTTTTGGGGGCGGAGCACCGTTCCTACCTCGTT	9: 20,910,131		probably null	Het
E4f1	AGGC	AGGCGGC	17: 24,455,183		probably benign	Het
Efhd2	CCGCCG	CCGCCGGCGCCG	4: 141,874,762		probably benign	Het
Entpd2	CTT	CTTT	2: 25,400,895		probably null	Het
Ephx2	A	G	14: 66,084,929		probably null	Het
Exd2	GCAGCAGCCGCAGCCACAGC	GCAGC	12: 80,475,915		probably benign	Het
Gabre	GCTC	GCTCCGTCTC	X: 72,270,054		probably benign	Het
H13	G	A	2: 152,669,669	E30K	probably damaging	Het
Herc1	G	C	9: 66,458,334	G324R		Het
Hsdl2	CAGCCACAGCTGCAG	CAGCCACAGCTGCAGCAGGAGCCACAGCTGCAG	4: 59,610,644		probably benign	Het
Il2	GCTTGAAG	GCTTGAAGCGGGCCTTGAAG	3: 37,125,820		probably benign	Het
Krtap28-10	CAG	CAGCCCTAG	1: 83,042,146		probably null	Het
Krtap28-10	ACAGC	ACAGCCACGGCCACCGCAGC	1: 83,042,286		probably benign	Het
Krtap4-9	GGCCCAGCTGCTGTGTGTCCAGCTGCTGCAG	GGCCCAGCTGCTGTGTGTCCAGCTGCTGCAGGCCCAGCTGCTGTGTGTCCAGCTGCTGCAG	11: 99,785,391		probably benign	Het
Lce1m	TGCTGCC	TGCTGCCCCCGCCGCTGCC	3: 93,018,280		probably benign	Het
Lrch1	TGGTGGTG	T	14: 74,947,566		probably null	Het
Mgam	C	T	6: 40,680,708	T999I	probably benign	Het
Mkl1	T	C	15: 81,015,856	E740G	probably damaging	Het
Nek1	A	G	8: 61,072,745		probably null	Het
Phactr2	T	A	10: 13,245,434	Q503H	probably benign	Het
Ptprd	T	C	4: 76,128,565	Y241C	probably damaging	Het
Rad51ap2	T	G	12: 11,458,075	V666G	possibly damaging	Het
Reep1	CC	CCCGAC	6: 71,707,968		probably null	Het
Rfx4	CTCTCTCTCT	CTCTCTCTCTCTCTCTCTGTCTCTCTCT	10: 84,858,485		probably benign	Het
Rnf126	AGGACGAGG	AG	10: 79,759,143		probably null	Het
Rnpc3	A	T	3: 113,620,074	S240T	probably damaging	Het
Rtbdn	GCAGCG	GCAGCGTCAGCG	8: 84,956,166		probably benign	Het
Sec31b	G	T	19: 44,535,787	A138D	probably damaging	Het
Syne1	A	T	10: 5,255,482	W3495R	probably damaging	Het
Tgoln1	CC	CCCGTGGGCTTGCCAGAATTACCTTC	6: 72,616,080		probably benign	Het
Tmtc3	T	C	10: 100,477,866	H48R	probably benign	Het
Vsig2	T	A	9: 37,539,263		probably null	Het
Wnk2	T	C	13: 49,146,779	T152A	probably benign	Het

Other mutations in Trappc9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Trappc9	APN	15	73026026	missense	possibly damaging	0.79
IGL01348:Trappc9	APN	15	72937009	missense	possibly damaging	0.64
IGL01367:Trappc9	APN	15	72590153	missense	probably benign	0.31
IGL01521:Trappc9	APN	15	73052167	missense	probably damaging	1.00
IGL01726:Trappc9	APN	15	72946122	missense	probably damaging	0.98
IGL01881:Trappc9	APN	15	72999992	missense	probably damaging	1.00
IGL02214:Trappc9	APN	15	73012882	nonsense	probably null
IGL02693:Trappc9	APN	15	72963693	splice site	probably benign
IGL03229:Trappc9	APN	15	73058456	missense	probably damaging	1.00
basilio	UTSW	15	73058393	missense	probably damaging	1.00
Boomboom	UTSW	15	72736869	nonsense	probably null
bronto	UTSW	15	73058238	nonsense	probably null
Earl	UTSW	15	72736777	nonsense	probably null
Sotto_aceto	UTSW	15	72685339	missense	probably damaging	0.99
P0026:Trappc9	UTSW	15	72953082	missense	probably damaging	1.00
PIT4453001:Trappc9	UTSW	15	73031598	frame shift	probably null
PIT4519001:Trappc9	UTSW	15	72953094	missense	probably benign
R0001:Trappc9	UTSW	15	72963662	missense	probably damaging	1.00
R0094:Trappc9	UTSW	15	72894929	intron	probably benign
R0745:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0747:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0800:Trappc9	UTSW	15	72953132	splice site	probably benign
R0816:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0819:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0820:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0893:Trappc9	UTSW	15	72590107	missense	probably damaging	1.00
R0976:Trappc9	UTSW	15	72999974	missense	probably damaging	0.99
R1119:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1266:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1453:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1454:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1531:Trappc9	UTSW	15	72693548	nonsense	probably null
R1543:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1563:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1565:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1600:Trappc9	UTSW	15	72937109	nonsense	probably null
R1712:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1756:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1789:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1978:Trappc9	UTSW	15	73000025	missense	probably damaging	1.00
R2001:Trappc9	UTSW	15	73058036	missense	probably damaging	0.99
R2312:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R2334:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R2926:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3123:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3124:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3125:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3813:Trappc9	UTSW	15	73058393	missense	probably damaging	1.00
R4012:Trappc9	UTSW	15	73031623	missense	possibly damaging	0.95
R4080:Trappc9	UTSW	15	72941947	missense	probably damaging	1.00
R4282:Trappc9	UTSW	15	72590792	missense	probably damaging	1.00
R4572:Trappc9	UTSW	15	72937067	missense	possibly damaging	0.61
R4739:Trappc9	UTSW	15	72937060	missense	probably damaging	0.97
R4959:Trappc9	UTSW	15	72937056	missense	probably damaging	1.00
R4973:Trappc9	UTSW	15	72937056	missense	probably damaging	1.00
R5123:Trappc9	UTSW	15	72913366	intron	probably benign
R5128:Trappc9	UTSW	15	73058393	missense	probably damaging	1.00
R5228:Trappc9	UTSW	15	73057995	missense	probably damaging	1.00
R5362:Trappc9	UTSW	15	73058217	missense	possibly damaging	0.68
R5802:Trappc9	UTSW	15	72685339	missense	probably damaging	0.99
R6032:Trappc9	UTSW	15	72925530	missense	probably benign	0.43
R6032:Trappc9	UTSW	15	72925530	missense	probably benign	0.43
R6154:Trappc9	UTSW	15	73058081	missense	probably benign	0.03
R6372:Trappc9	UTSW	15	72590074	missense	possibly damaging	0.75
R6661:Trappc9	UTSW	15	72590144	missense	possibly damaging	0.55
R6864:Trappc9	UTSW	15	72937162	splice site	probably null
R6893:Trappc9	UTSW	15	72925650	missense	possibly damaging	0.93
R7099:Trappc9	UTSW	15	72693619	missense	probably benign	0.00
R7276:Trappc9	UTSW	15	73052270	missense	probably damaging	0.99
R7349:Trappc9	UTSW	15	72736869	nonsense	probably null
R8260:Trappc9	UTSW	15	72941909	nonsense	probably null
R8399:Trappc9	UTSW	15	73052282	missense	probably damaging	1.00
R8683:Trappc9	UTSW	15	73012815	missense	probably benign	0.26
R8839:Trappc9	UTSW	15	73058238	nonsense	probably null
R8945:Trappc9	UTSW	15	73058096	missense	probably benign
R9083:Trappc9	UTSW	15	72736777	nonsense	probably null
R9323:Trappc9	UTSW	15	72693582	missense	probably benign	0.41
R9329:Trappc9	UTSW	15	72801353	missense	unknown
R9366:Trappc9	UTSW	15	72937088	missense	probably benign
R9723:Trappc9	UTSW	15	72590114	missense	possibly damaging	0.87
RF008:Trappc9	UTSW	15	72801289	small insertion	probably benign
RF009:Trappc9	UTSW	15	72801287	small insertion	probably benign
RF014:Trappc9	UTSW	15	72801283	small insertion	probably benign
RF016:Trappc9	UTSW	15	72801289	small insertion	probably benign
RF023:Trappc9	UTSW	15	72801331	small insertion	probably benign
RF028:Trappc9	UTSW	15	72801290	small insertion	probably benign
RF029:Trappc9	UTSW	15	72801323	small insertion	probably benign
RF030:Trappc9	UTSW	15	72801325	small insertion	probably benign
RF034:Trappc9	UTSW	15	72801298	small insertion	probably benign
RF036:Trappc9	UTSW	15	72801320	small insertion	probably benign
RF038:Trappc9	UTSW	15	72801323	small insertion	probably benign
RF040:Trappc9	UTSW	15	72801292	small insertion	probably benign
RF042:Trappc9	UTSW	15	72801283	small insertion	probably benign
RF043:Trappc9	UTSW	15	72801305	small insertion	probably benign
RF049:Trappc9	UTSW	15	72801301	small insertion	probably benign
RF049:Trappc9	UTSW	15	72801306	small insertion	probably benign
RF053:Trappc9	UTSW	15	72801328	small insertion	probably benign
RF057:Trappc9	UTSW	15	72801295	small insertion	probably benign
RF063:Trappc9	UTSW	15	72801320	small insertion	probably benign
RF063:Trappc9	UTSW	15	72801324	small insertion	probably benign
Z1177:Trappc9	UTSW	15	73052162	missense	probably null	0.51

Predicted Primers

PCR Primer
(F):5'- TCACATACATCTGCCAGCACTG -3'
(R):5'- AAGGATCCTAGTGCTGGACTTG -3'

Sequencing Primer
(F):5'- CAGCACTGCCCCTCCAG -3'
(R):5'- CAGCTGTTTAATGTCAGGC -3'

Posted On

2019-12-04