Incidental Mutation 'RF023:Trappc9'
ID604016
Institutional Source Beutler Lab
Gene Symbol Trappc9
Ensembl Gene ENSMUSG00000047921
Gene Nametrafficking protein particle complex 9
SynonymsTRS130, Nibp, 2900005P22Rik, 4632408O18Rik, 1810044A24Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF023 (G1)
Quality Score217.468
Status Not validated
Chromosome15
Chromosomal Location72589620-73061204 bp(-) (GRCm38)
Type of Mutationsmall insertion (5 aa in frame mutation)
DNA Base Change (assembly) T to TGCTGCTGCTGCTGCC at 72801331 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023276] [ENSMUST00000089770] [ENSMUST00000170633]
Predicted Effect probably benign
Transcript: ENSMUST00000023276
SMART Domains Protein: ENSMUSP00000023276
Gene: ENSMUSG00000047921

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 2 920 3.6e-239 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000089770
SMART Domains Protein: ENSMUSP00000087202
Gene: ENSMUSG00000047921

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 182 350 4.1e-20 PFAM
Pfam:TRAPPC9-Trs120 434 664 2.2e-16 PFAM
low complexity region 993 1004 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170633
SMART Domains Protein: ENSMUSP00000131997
Gene: ENSMUSG00000047921

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 1 820 7.6e-224 PFAM
coiled coil region 857 885 N/A INTRINSIC
low complexity region 906 929 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency 96% (24/25)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that likely plays a role in NF-kappa-B signaling. Mutations in this gene have been associated with autosomal-recessive mental retardation. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T TTATTATTATTATTAG 3: 37,050,760 probably benign Het
5430401F13Rik ACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG ACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,855 probably benign Het
5430401F13Rik AAAAACAGAAAGGAAAAGGTGGCCAG AAAAACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,878 probably benign Het
A030005L19Rik TTGCTGTGGCTGTGGAGGTTGTGGCGGCTGTGGCTGTGG TGGCTGTGGCTGTGG 1: 82,913,396 probably benign Het
Amot GCAACAGCAAC GC X: 145,451,003 probably benign Het
Anks1b G A 10: 90,033,225 G49D probably damaging Het
Arhgef5 T A 6: 43,279,473 S1172T probably damaging Het
Cacna2d4 G A 6: 119,268,230 V300I probably benign Het
Calhm1 GTGGC GTGGCTGTGGCTTTGGC 19: 47,141,273 probably benign Het
Camk2b T C 11: 5,972,301 T516A probably damaging Het
Ccdc170 CCA CCAACA 10: 4,561,018 probably benign Het
Cdhr3 G T 12: 33,060,349 S312Y probably damaging Het
Cdk1 C T 10: 69,340,498 G260S possibly damaging Het
Cdsn AG AGACAGGAAGTAGTAGCTCTCAG 17: 35,554,979 probably benign Het
Cenpp A T 13: 49,650,144 V88E probably benign Het
Cfap46 TCTTCTCCCTCTCCTTCTCCTTCTCCTTCTCC TCTTCTCCTTCTCCTTCTCC 7: 139,638,918 Het
Dnah11 T A 12: 117,954,850 R3449W probably damaging Het
Dnmt1 AGTTCCTACCTCGTT AGTTCCTACCTCGTTTTGGGGGCGGAGCACCGTTCCTACCTCGTT 9: 20,910,131 probably null Het
E4f1 AGGC AGGCGGC 17: 24,455,183 probably benign Het
Efhd2 CCGCCG CCGCCGGCGCCG 4: 141,874,762 probably benign Het
Entpd2 CTT CTTT 2: 25,400,895 probably null Het
Ephx2 A G 14: 66,084,929 probably null Het
Exd2 GCAGCAGCCGCAGCCACAGC GCAGC 12: 80,475,915 probably benign Het
Gabre GCTC GCTCCGTCTC X: 72,270,054 probably benign Het
H13 G A 2: 152,669,669 E30K probably damaging Het
Herc1 G C 9: 66,458,334 G324R Het
Hsdl2 CAGCCACAGCTGCAG CAGCCACAGCTGCAGCAGGAGCCACAGCTGCAG 4: 59,610,644 probably benign Het
Il2 GCTTGAAG GCTTGAAGCGGGCCTTGAAG 3: 37,125,820 probably benign Het
Krtap28-10 ACAGC ACAGCCACGGCCACCGCAGC 1: 83,042,286 probably benign Het
Krtap28-10 CAG CAGCCCTAG 1: 83,042,146 probably null Het
Krtap4-9 GGCCCAGCTGCTGTGTGTCCAGCTGCTGCAG GGCCCAGCTGCTGTGTGTCCAGCTGCTGCAGGCCCAGCTGCTGTGTGTCCAGCTGCTGCAG 11: 99,785,391 probably benign Het
Lce1m TGCTGCC TGCTGCCCCCGCCGCTGCC 3: 93,018,280 probably benign Het
Lrch1 TGGTGGTG T 14: 74,947,566 probably null Het
Mgam C T 6: 40,680,708 T999I probably benign Het
Mkl1 T C 15: 81,015,856 E740G probably damaging Het
Nek1 A G 8: 61,072,745 probably null Het
Phactr2 T A 10: 13,245,434 Q503H probably benign Het
Ptprd T C 4: 76,128,565 Y241C probably damaging Het
Rad51ap2 T G 12: 11,458,075 V666G possibly damaging Het
Reep1 CC CCCGAC 6: 71,707,968 probably null Het
Rfx4 CTCTCTCTCT CTCTCTCTCTCTCTCTCTGTCTCTCTCT 10: 84,858,485 probably benign Het
Rnf126 AGGACGAGG AG 10: 79,759,143 probably null Het
Rnpc3 A T 3: 113,620,074 S240T probably damaging Het
Rtbdn GCAGCG GCAGCGTCAGCG 8: 84,956,166 probably benign Het
Sec31b G T 19: 44,535,787 A138D probably damaging Het
Syne1 A T 10: 5,255,482 W3495R probably damaging Het
Tgoln1 CC CCCGTGGGCTTGCCAGAATTACCTTC 6: 72,616,080 probably benign Het
Tmtc3 T C 10: 100,477,866 H48R probably benign Het
Vsig2 T A 9: 37,539,263 probably null Het
Wnk2 T C 13: 49,146,779 T152A probably benign Het
Other mutations in Trappc9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Trappc9 APN 15 73026026 missense possibly damaging 0.79
IGL01348:Trappc9 APN 15 72937009 missense possibly damaging 0.64
IGL01367:Trappc9 APN 15 72590153 missense probably benign 0.31
IGL01521:Trappc9 APN 15 73052167 missense probably damaging 1.00
IGL01726:Trappc9 APN 15 72946122 missense probably damaging 0.98
IGL01881:Trappc9 APN 15 72999992 missense probably damaging 1.00
IGL02214:Trappc9 APN 15 73012882 nonsense probably null
IGL02693:Trappc9 APN 15 72963693 splice site probably benign
IGL03229:Trappc9 APN 15 73058456 missense probably damaging 1.00
basilio UTSW 15 73058393 missense probably damaging 1.00
Boomboom UTSW 15 72736869 nonsense probably null
Sotto_aceto UTSW 15 72685339 missense probably damaging 0.99
P0026:Trappc9 UTSW 15 72953082 missense probably damaging 1.00
PIT4453001:Trappc9 UTSW 15 73031598 frame shift probably null
PIT4519001:Trappc9 UTSW 15 72953094 missense probably benign
R0001:Trappc9 UTSW 15 72963662 missense probably damaging 1.00
R0094:Trappc9 UTSW 15 72894929 intron probably benign
R0745:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0747:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0800:Trappc9 UTSW 15 72953132 splice site probably benign
R0816:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0819:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0820:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0893:Trappc9 UTSW 15 72590107 missense probably damaging 1.00
R0976:Trappc9 UTSW 15 72999974 missense probably damaging 0.99
R1119:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1266:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1453:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1454:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1531:Trappc9 UTSW 15 72693548 nonsense probably null
R1543:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1563:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1565:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1600:Trappc9 UTSW 15 72937109 nonsense probably null
R1712:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1756:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1789:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1978:Trappc9 UTSW 15 73000025 missense probably damaging 1.00
R2001:Trappc9 UTSW 15 73058036 missense probably damaging 0.99
R2312:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R2334:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R2926:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3123:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3124:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3125:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3813:Trappc9 UTSW 15 73058393 missense probably damaging 1.00
R4012:Trappc9 UTSW 15 73031623 missense possibly damaging 0.95
R4080:Trappc9 UTSW 15 72941947 missense probably damaging 1.00
R4282:Trappc9 UTSW 15 72590792 missense probably damaging 1.00
R4572:Trappc9 UTSW 15 72937067 missense possibly damaging 0.61
R4739:Trappc9 UTSW 15 72937060 missense probably damaging 0.97
R4959:Trappc9 UTSW 15 72937056 missense probably damaging 1.00
R4973:Trappc9 UTSW 15 72937056 missense probably damaging 1.00
R5123:Trappc9 UTSW 15 72913366 intron probably benign
R5128:Trappc9 UTSW 15 73058393 missense probably damaging 1.00
R5228:Trappc9 UTSW 15 73057995 missense probably damaging 1.00
R5362:Trappc9 UTSW 15 73058217 missense possibly damaging 0.68
R5802:Trappc9 UTSW 15 72685339 missense probably damaging 0.99
R6032:Trappc9 UTSW 15 72925530 missense probably benign 0.43
R6032:Trappc9 UTSW 15 72925530 missense probably benign 0.43
R6154:Trappc9 UTSW 15 73058081 missense probably benign 0.03
R6372:Trappc9 UTSW 15 72590074 missense possibly damaging 0.75
R6661:Trappc9 UTSW 15 72590144 missense possibly damaging 0.55
R6864:Trappc9 UTSW 15 72937162 splice site probably null
R6893:Trappc9 UTSW 15 72925650 missense possibly damaging 0.93
R7099:Trappc9 UTSW 15 72693619 missense probably benign 0.00
R7276:Trappc9 UTSW 15 73052270 missense probably damaging 0.99
R7349:Trappc9 UTSW 15 72736869 nonsense probably null
R8260:Trappc9 UTSW 15 72941909 nonsense probably null
R8399:Trappc9 UTSW 15 73052282 missense probably damaging 1.00
RF008:Trappc9 UTSW 15 72801289 small insertion probably benign
RF009:Trappc9 UTSW 15 72801287 small insertion probably benign
RF014:Trappc9 UTSW 15 72801283 small insertion probably benign
RF016:Trappc9 UTSW 15 72801289 small insertion probably benign
RF023:Trappc9 UTSW 15 72801324 small insertion probably benign
RF028:Trappc9 UTSW 15 72801290 small insertion probably benign
RF029:Trappc9 UTSW 15 72801323 small insertion probably benign
RF030:Trappc9 UTSW 15 72801325 small insertion probably benign
RF034:Trappc9 UTSW 15 72801298 small insertion probably benign
RF036:Trappc9 UTSW 15 72801320 small insertion probably benign
RF038:Trappc9 UTSW 15 72801323 small insertion probably benign
RF040:Trappc9 UTSW 15 72801292 small insertion probably benign
RF042:Trappc9 UTSW 15 72801283 small insertion probably benign
RF043:Trappc9 UTSW 15 72801305 small insertion probably benign
RF049:Trappc9 UTSW 15 72801301 small insertion probably benign
RF049:Trappc9 UTSW 15 72801306 small insertion probably benign
RF053:Trappc9 UTSW 15 72801328 small insertion probably benign
RF057:Trappc9 UTSW 15 72801295 small insertion probably benign
RF063:Trappc9 UTSW 15 72801320 small insertion probably benign
RF063:Trappc9 UTSW 15 72801324 small insertion probably benign
Z1177:Trappc9 UTSW 15 73052162 missense probably null 0.51
Predicted Primers PCR Primer
(F):5'- ATACATCTGCCAGCACTGC -3'
(R):5'- GGATCCTAGTGCTGGACTTG -3'

Sequencing Primer
(F):5'- CAGCACTGCCCCTCCAG -3'
(R):5'- GGCAGCTGTTTAATGTCAG -3'
Posted On2019-12-04