Incidental Mutation 'RF024:Ubn2'
ID604051
Institutional Source Beutler Lab
Gene Symbol Ubn2
Ensembl Gene ENSMUSG00000038538
Gene Nameubinuclein 2
SynonymsD130059P03Rik, 6030408G03Rik, 2900060J04Rik
Accession Numbers

Genbank: NM_177185; MGI: 2444236

Is this an essential gene? Possibly essential (E-score: 0.686) question?
Stock #RF024 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location38433950-38524825 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 38463628 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 313 (M313K)
Ref Sequence ENSEMBL: ENSMUSP00000036188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039127] [ENSMUST00000160583] [ENSMUST00000162593]
Predicted Effect probably damaging
Transcript: ENSMUST00000039127
AA Change: M313K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000036188
Gene: ENSMUSG00000038538
AA Change: M313K

DomainStartEndE-ValueType
low complexity region 34 57 N/A INTRINSIC
low complexity region 74 109 N/A INTRINSIC
Pfam:HUN 180 231 4.8e-22 PFAM
low complexity region 256 285 N/A INTRINSIC
low complexity region 294 309 N/A INTRINSIC
low complexity region 328 345 N/A INTRINSIC
low complexity region 389 399 N/A INTRINSIC
Pfam:UBN_AB 434 650 6.4e-80 PFAM
low complexity region 687 717 N/A INTRINSIC
low complexity region 822 833 N/A INTRINSIC
low complexity region 846 881 N/A INTRINSIC
low complexity region 1002 1042 N/A INTRINSIC
low complexity region 1156 1168 N/A INTRINSIC
low complexity region 1180 1199 N/A INTRINSIC
low complexity region 1247 1263 N/A INTRINSIC
low complexity region 1280 1297 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160583
AA Change: M313K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124043
Gene: ENSMUSG00000038538
AA Change: M313K

DomainStartEndE-ValueType
low complexity region 34 57 N/A INTRINSIC
low complexity region 74 109 N/A INTRINSIC
Pfam:HUN 178 232 3.8e-23 PFAM
low complexity region 256 285 N/A INTRINSIC
low complexity region 294 309 N/A INTRINSIC
low complexity region 328 345 N/A INTRINSIC
low complexity region 389 399 N/A INTRINSIC
Pfam:UBN_AB 434 650 2.9e-86 PFAM
low complexity region 685 715 N/A INTRINSIC
low complexity region 820 831 N/A INTRINSIC
low complexity region 844 879 N/A INTRINSIC
low complexity region 1000 1040 N/A INTRINSIC
low complexity region 1154 1166 N/A INTRINSIC
low complexity region 1178 1197 N/A INTRINSIC
low complexity region 1245 1261 N/A INTRINSIC
low complexity region 1278 1295 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162593
AA Change: M145K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124352
Gene: ENSMUSG00000038538
AA Change: M145K

DomainStartEndE-ValueType
Pfam:HUN 10 64 4.4e-24 PFAM
low complexity region 88 117 N/A INTRINSIC
low complexity region 126 141 N/A INTRINSIC
low complexity region 160 177 N/A INTRINSIC
low complexity region 221 231 N/A INTRINSIC
Pfam:UBN_AB 266 482 3.1e-87 PFAM
low complexity region 534 564 N/A INTRINSIC
low complexity region 669 680 N/A INTRINSIC
low complexity region 693 728 N/A INTRINSIC
low complexity region 849 889 N/A INTRINSIC
low complexity region 1003 1015 N/A INTRINSIC
low complexity region 1027 1039 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI

All alleles(14) : Gene trapped(14)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 G T 4: 53,049,125 T1651N probably damaging Het
Abca17 T TACCTG 17: 24,287,732 probably null Het
Ank1 T A 8: 23,119,344 F1380I probably benign Het
Apcs A T 1: 172,894,242 M179K probably damaging Het
Asb7 C T 7: 66,647,883 R287Q probably damaging Het
Begain G GCCGCCT 12: 109,033,437 probably null Het
Cacna2d1 A G 5: 16,025,776 T69A possibly damaging Het
Ccdc170 CCA CCAACA 10: 4,561,024 probably benign Het
Ccdc69 A G 11: 55,060,523 L24P probably damaging Het
Cdh16 T G 8: 104,617,052 N604T probably damaging Het
Crybg1 A G 10: 44,004,745 V149A probably benign Het
Cyb5r4 ACACTGCCCAGGGA ACACTGCCCAGGGATGTGACAGACGCACTGCCCAGGGA 9: 87,040,435 probably benign Het
Dnmt1 CAGTTCCTACCTCGTT CAGTTCCTACCTCGTTTTGGGGGCGGAGCAAAGTTCCTACCTCGTT 9: 20,910,130 probably null Het
Dnmt1 ACCTCGTT ACCTCGTTTTGGGGGCGGAGCACAGTTCCTCCCTCGTT 9: 20,910,138 probably benign Het
Efhd2 CCGCCG CCGCCGACGCCG 4: 141,874,762 probably benign Het
Enah GTGGCGGC G 1: 181,921,934 probably null Het
Entpd2 CTT CTTT 2: 25,400,895 probably null Het
Epha2 CCCCC CCCCCC 4: 141,323,406 unknown Het
Fam114a2 T C 11: 57,493,033 T359A probably benign Het
Farp1 A G 14: 121,237,148 I258V probably damaging Het
Fbxw28 G T 9: 109,338,526 Y54* probably null Het
Gabre CAGGCTCA C X: 72,270,177 probably null Het
Gm17660 A C 5: 104,074,859 probably null Het
Gprc5d A T 6: 135,116,519 L130Q probably damaging Het
H13 G A 2: 152,669,669 E30K probably damaging Het
Herc2 C T 7: 56,226,525 R4429C probably damaging Het
Kif21b A T 1: 136,158,341 T817S probably damaging Het
Kl A C 5: 150,953,420 Y235S probably benign Het
Klk5 T A 7: 43,842,374 V20D possibly damaging Het
Krtap28-10 TCCCACA TCCCACACCCACA 1: 83,042,123 probably benign Het
Krtap28-10 CAC CACGACAGCCACAGCAAC 1: 83,042,252 probably benign Het
Lamc2 T A 1: 153,152,055 T208S possibly damaging Het
Map1a GCTCCAGCTCCA GCTCCAGCTCCAGCTCCAGCTCCAGCTCCATCTCCAGCTCCA 2: 121,306,307 probably benign Het
Map3k5 A T 10: 20,100,172 N804I probably damaging Het
Map6d1 G A 16: 20,241,000 T105I probably benign Het
Mbd1 TGTCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC TATCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC 18: 74,273,573 probably benign Het
Mbd1 GTCTTCGTCTGCATCTGCATCTGCATCT GTCT 18: 74,273,610 probably benign Het
Mkl1 TTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTG 15: 81,018,255 probably benign Het
Mrgprx1 A AGAC 7: 48,021,511 probably benign Het
Mroh2a C A 1: 88,242,485 L710M probably damaging Het
Msmb A G 14: 32,158,090 D79G probably damaging Het
Nab2 A T 10: 127,664,364 D286E probably benign Het
Nrxn1 G A 17: 90,362,876 R1144C probably damaging Het
Otog A T 7: 46,287,669 T1601S probably damaging Het
Pan2 G A 10: 128,315,535 E842K probably benign Het
Pcca C T 14: 122,684,898 T357I probably damaging Het
Pcnx C T 12: 81,917,727 P223S probably damaging Het
Prop1 A C 11: 50,951,130 Y150D possibly damaging Het
Prss56 T C 1: 87,187,170 L465P probably benign Het
Psip1 T C 4: 83,460,498 I353M probably damaging Het
Rapgef3 A C 15: 97,760,740 H170Q probably benign Het
Rasal2 A T 1: 157,147,790 S1150T probably damaging Het
Rtbdn C CAGCGGA 8: 84,956,179 probably benign Het
Sap30bp T A 11: 115,960,507 I135N probably damaging Het
Sbp ATG ATGCTGACAACAAAGCTG 17: 23,945,387 probably benign Het
Slc35e4 A T 11: 3,907,960 L215Q possibly damaging Het
Smarca2 CAGC CAGCCCAAGC 19: 26,631,020 probably benign Het
Surf4 A T 2: 26,922,167 I183N probably benign Het
Tcof1 CAG CAGAAG 18: 60,835,738 probably benign Het
Timm23 T A 14: 32,180,555 *210C probably null Het
Tnfaip8 ACACACACACACACACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC AC 18: 50,046,831 probably benign Het
Trim66 A T 7: 109,460,740 L813Q possibly damaging Het
Trip10 G A 17: 57,255,045 A224T probably benign Het
Ttn T C 2: 76,907,599 T4245A unknown Het
Ttn T A 2: 76,908,025 I4103F unknown Het
Ubr5 T C 15: 38,028,652 N521S Het
Utp20 A T 10: 88,825,457 D29E probably damaging Het
Vmn2r60 T A 7: 42,140,939 V450E probably benign Het
Wdr66 GAGGAGGAAGAGGAGGAAGAGGAGGGGGAGAAGGAG GAGGAGGAAGAGGAGGAAGAGGAGGGGGAGAAGGAGGAAAAGGAGGAAGAGGAGGAAGAGGAGGGGGAGAAGGAG 5: 123,253,883 probably benign Het
Wdr66 GGAAGAGGAGGAAGAGGAGGGGGAGAAGGAG GGAAGAGGAGGAAGAGGAGGGGGAGAAGGAGGAAAAGGAGGAAGAGGAGGAAGAGGAGGGGGAGAAGGAG 5: 123,253,888 probably benign Het
Wdr66 GAAGAGGAGGAAGAGGAGGGGGAGAAGGAG GAAGAGGAGGAAGAGGAGGGGGAGAAGGAGGAAAAGGAGAAAGAGGAGGAAGAGGAGGGGGAGAAGGAG 5: 123,253,889 probably benign Het
Wnt6 A T 1: 74,782,821 D187V probably damaging Het
Zc3h14 T C 12: 98,758,861 C261R probably damaging Het
Zfp384 GCCCAGGC GCCCAGGCCCAGCCCCAGGC 6: 125,036,489 probably benign Het
Zfp395 C T 14: 65,385,425 S3F unknown Het
Zfp583 T A 7: 6,316,982 I344F probably damaging Het
Zfp599 A C 9: 22,253,884 V65G probably benign Het
Zfp808 T C 13: 62,171,299 V114A probably benign Het
Zfp933 G A 4: 147,826,441 H233Y probably damaging Het
Znrd1as CACCACCACCACCAC CACCACCACCACCACCACCACTACCACCACCACCAC 17: 36,965,057 probably benign Het
Other mutations in Ubn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Ubn2 APN 6 38482605 missense possibly damaging 0.91
IGL03116:Ubn2 APN 6 38491899 missense probably damaging 1.00
IGL03150:Ubn2 APN 6 38463714 missense probably benign
IGL03382:Ubn2 APN 6 38440447 unclassified probably benign
A4554:Ubn2 UTSW 6 38484110 missense probably damaging 1.00
R0008:Ubn2 UTSW 6 38434600 critical splice donor site probably null
R0034:Ubn2 UTSW 6 38491406 synonymous silent
R0121:Ubn2 UTSW 6 38452858 splice site probably benign
R0267:Ubn2 UTSW 6 38482618 critical splice donor site probably null
R1864:Ubn2 UTSW 6 38440490 missense possibly damaging 0.93
R1865:Ubn2 UTSW 6 38440490 missense possibly damaging 0.93
R1892:Ubn2 UTSW 6 38491291 missense probably damaging 1.00
R2174:Ubn2 UTSW 6 38470141 splice site probably null
R2184:Ubn2 UTSW 6 38484094 missense probably damaging 1.00
R2212:Ubn2 UTSW 6 38498739 missense probably benign 0.03
R2442:Ubn2 UTSW 6 38491005 missense probably benign 0.00
R3413:Ubn2 UTSW 6 38498739 missense probably benign 0.03
R4725:Ubn2 UTSW 6 38522305 utr 3 prime probably benign
R4765:Ubn2 UTSW 6 38479140 missense probably damaging 1.00
R4771:Ubn2 UTSW 6 38487153 splice site probably null
R4812:Ubn2 UTSW 6 38463726 missense probably benign
R4934:Ubn2 UTSW 6 38490498 missense probably benign 0.04
R5580:Ubn2 UTSW 6 38483252 missense probably damaging 0.99
R5598:Ubn2 UTSW 6 38490388 missense probably benign 0.00
R5672:Ubn2 UTSW 6 38461527 missense probably damaging 1.00
R5715:Ubn2 UTSW 6 38461477 nonsense probably null
R5817:Ubn2 UTSW 6 38479153 missense probably damaging 1.00
R5919:Ubn2 UTSW 6 38491488 missense possibly damaging 0.50
R5937:Ubn2 UTSW 6 38463982 missense possibly damaging 0.74
R6033:Ubn2 UTSW 6 38470224 critical splice donor site probably null
R6033:Ubn2 UTSW 6 38470224 critical splice donor site probably null
R6174:Ubn2 UTSW 6 38461536 missense probably damaging 1.00
R6338:Ubn2 UTSW 6 38490714 missense probably benign 0.00
R6653:Ubn2 UTSW 6 38434462 missense possibly damaging 0.72
R7282:Ubn2 UTSW 6 38452876 nonsense probably null
R7685:Ubn2 UTSW 6 38491792 missense probably benign 0.02
R7727:Ubn2 UTSW 6 38463938 missense probably benign 0.08
R7777:Ubn2 UTSW 6 38490753 missense probably damaging 1.00
R8074:Ubn2 UTSW 6 38440540 missense probably benign 0.13
X0010:Ubn2 UTSW 6 38483120 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TTGAAGCTGCTAACGTGAAAG -3'
(R):5'- AGGGCATTTTCAGCTTCCTG -3'

Sequencing Primer
(F):5'- GAAAATAACTTTGTTCTGCCATCTCC -3'
(R):5'- CAGCTTCCTGAAACAGTTCATG -3'
Posted On2019-12-04