Incidental Mutation 'RF024:Herc2'
ID604059
Institutional Source Beutler Lab
Gene Symbol Herc2
Ensembl Gene ENSMUSG00000030451
Gene NameHECT and RLD domain containing E3 ubiquitin protein ligase 2
SynonymsD7H15F37S1, D7H15F32S1, rjs, jdf2, D15F32S1h
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock #RF024 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location56050196-56231800 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 56226525 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 4429 (R4429C)
Ref Sequence ENSEMBL: ENSMUSP00000075579 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076226] [ENSMUST00000164095] [ENSMUST00000205303]
Predicted Effect probably damaging
Transcript: ENSMUST00000076226
AA Change: R4429C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075579
Gene: ENSMUSG00000030451
AA Change: R4429C

DomainStartEndE-ValueType
low complexity region 73 87 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 198 212 N/A INTRINSIC
low complexity region 272 281 N/A INTRINSIC
low complexity region 304 317 N/A INTRINSIC
Pfam:RCC1 514 567 7.6e-16 PFAM
Pfam:RCC1_2 554 583 6e-9 PFAM
Pfam:RCC1 570 615 7.1e-17 PFAM
Pfam:RCC1_2 606 637 6.9e-8 PFAM
Pfam:RCC1 624 673 7.2e-15 PFAM
Pfam:RCC1 676 725 3.3e-18 PFAM
Pfam:RCC1_2 712 740 1.6e-9 PFAM
low complexity region 854 866 N/A INTRINSIC
low complexity region 902 913 N/A INTRINSIC
coiled coil region 950 977 N/A INTRINSIC
low complexity region 1052 1066 N/A INTRINSIC
Cyt-b5 1211 1284 1.08e-1 SMART
low complexity region 1310 1316 N/A INTRINSIC
low complexity region 1440 1446 N/A INTRINSIC
low complexity region 1545 1563 N/A INTRINSIC
coiled coil region 1651 1674 N/A INTRINSIC
Pfam:MIB_HERC2 1871 1933 5.8e-29 PFAM
low complexity region 1939 1952 N/A INTRINSIC
low complexity region 2211 2222 N/A INTRINSIC
low complexity region 2381 2388 N/A INTRINSIC
low complexity region 2402 2416 N/A INTRINSIC
low complexity region 2521 2540 N/A INTRINSIC
Pfam:Cul7 2555 2633 2.6e-43 PFAM
ZnF_ZZ 2703 2747 5.39e-11 SMART
APC10 2780 2933 5.1e-41 SMART
TECPR 2978 3019 7.59e0 SMART
Pfam:RCC1_2 3048 3079 9.2e-8 PFAM
Pfam:RCC1 3066 3115 3.7e-17 PFAM
Pfam:RCC1_2 3102 3131 3.9e-11 PFAM
Pfam:RCC1 3118 3162 1.9e-15 PFAM
Pfam:RCC1 3172 3221 9.6e-15 PFAM
Pfam:RCC1_2 3208 3236 2.2e-7 PFAM
TECPR 3241 3284 1.32e2 SMART
low complexity region 3357 3365 N/A INTRINSIC
low complexity region 3430 3447 N/A INTRINSIC
low complexity region 3480 3495 N/A INTRINSIC
low complexity region 3755 3771 N/A INTRINSIC
TECPR 3972 4012 2.41e1 SMART
Pfam:RCC1_2 4041 4072 5.1e-8 PFAM
Pfam:RCC1 4059 4108 1.5e-16 PFAM
Pfam:RCC1 4111 4155 7.9e-16 PFAM
TECPR 4184 4225 8.42e1 SMART
Pfam:RCC1_2 4253 4282 4.3e-10 PFAM
Pfam:RCC1 4269 4318 1.2e-17 PFAM
Blast:HECTc 4340 4425 6e-18 BLAST
HECTc 4455 4801 1.37e-62 SMART
low complexity region 4808 4828 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164095
AA Change: R4429C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131573
Gene: ENSMUSG00000030451
AA Change: R4429C

DomainStartEndE-ValueType
low complexity region 73 87 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 198 212 N/A INTRINSIC
low complexity region 272 281 N/A INTRINSIC
low complexity region 304 317 N/A INTRINSIC
Pfam:RCC1 514 567 2.9e-15 PFAM
Pfam:RCC1_2 554 583 1.6e-8 PFAM
Pfam:RCC1 570 615 2.3e-16 PFAM
Pfam:RCC1 624 673 1.2e-14 PFAM
Pfam:RCC1_2 660 689 2.1e-7 PFAM
Pfam:RCC1 676 725 9.8e-18 PFAM
Pfam:RCC1_2 712 740 1.1e-9 PFAM
low complexity region 854 866 N/A INTRINSIC
low complexity region 902 913 N/A INTRINSIC
coiled coil region 950 977 N/A INTRINSIC
low complexity region 1052 1066 N/A INTRINSIC
Cyt-b5 1211 1284 1.08e-1 SMART
low complexity region 1310 1316 N/A INTRINSIC
low complexity region 1440 1446 N/A INTRINSIC
low complexity region 1545 1563 N/A INTRINSIC
coiled coil region 1651 1674 N/A INTRINSIC
Pfam:MIB_HERC2 1871 1931 9.3e-25 PFAM
low complexity region 1939 1952 N/A INTRINSIC
low complexity region 2211 2222 N/A INTRINSIC
low complexity region 2381 2388 N/A INTRINSIC
low complexity region 2402 2416 N/A INTRINSIC
low complexity region 2521 2540 N/A INTRINSIC
Pfam:Cul7 2555 2632 1.4e-39 PFAM
ZnF_ZZ 2703 2747 5.39e-11 SMART
APC10 2780 2933 5.1e-41 SMART
TECPR 2978 3019 7.59e0 SMART
Pfam:RCC1_2 3048 3079 1.6e-7 PFAM
Pfam:RCC1 3066 3115 7.1e-16 PFAM
Pfam:RCC1_2 3102 3131 7.1e-11 PFAM
Pfam:RCC1 3118 3163 1.2e-14 PFAM
Pfam:RCC1 3172 3221 4.7e-15 PFAM
TECPR 3241 3284 1.32e2 SMART
low complexity region 3357 3365 N/A INTRINSIC
low complexity region 3430 3447 N/A INTRINSIC
low complexity region 3480 3495 N/A INTRINSIC
low complexity region 3755 3771 N/A INTRINSIC
TECPR 3972 4012 2.41e1 SMART
Pfam:RCC1_2 4041 4072 1.2e-7 PFAM
Pfam:RCC1 4059 4108 9.6e-15 PFAM
Pfam:RCC1 4111 4156 5.6e-15 PFAM
TECPR 4184 4225 8.42e1 SMART
Pfam:RCC1_2 4253 4282 7.3e-10 PFAM
Pfam:RCC1 4269 4318 1.6e-16 PFAM
Blast:HECTc 4340 4425 6e-18 BLAST
HECTc 4455 4801 1.37e-62 SMART
low complexity region 4808 4828 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000205303
AA Change: R4393C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000205678
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the HERC gene family that encodes a group of unusually large proteins, which contain multiple structural domains. All members have at least 1 copy of an N-terminal region showing homology to the cell cycle regulator RCC1 and a C-terminal HECT (homologous to E6-AP C terminus) domain found in a number of E3 ubiquitin protein ligases. Genetic variations in this gene are associated with skin/hair/eye pigmentation variability. Multiple pseudogenes of this gene are located on chromosomes 15 and 16. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygotes for null mutations exhibit runting, nervousness, and incoordination. Males are sterile with sperm abnormalities, while females show reduced fertility and impaired maternal ability. Also see alleles at the Oca2 (p) locus for deletions that encompass the Herc2 gene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 G T 4: 53,049,125 T1651N probably damaging Het
Abca17 T TACCTG 17: 24,287,732 probably null Het
Ank1 T A 8: 23,119,344 F1380I probably benign Het
Apcs A T 1: 172,894,242 M179K probably damaging Het
Asb7 C T 7: 66,647,883 R287Q probably damaging Het
Begain G GCCGCCT 12: 109,033,437 probably null Het
Cacna2d1 A G 5: 16,025,776 T69A possibly damaging Het
Ccdc170 CCA CCAACA 10: 4,561,024 probably benign Het
Ccdc69 A G 11: 55,060,523 L24P probably damaging Het
Cdh16 T G 8: 104,617,052 N604T probably damaging Het
Crybg1 A G 10: 44,004,745 V149A probably benign Het
Cyb5r4 ACACTGCCCAGGGA ACACTGCCCAGGGATGTGACAGACGCACTGCCCAGGGA 9: 87,040,435 probably benign Het
Dnmt1 CAGTTCCTACCTCGTT CAGTTCCTACCTCGTTTTGGGGGCGGAGCAAAGTTCCTACCTCGTT 9: 20,910,130 probably null Het
Dnmt1 ACCTCGTT ACCTCGTTTTGGGGGCGGAGCACAGTTCCTCCCTCGTT 9: 20,910,138 probably benign Het
Efhd2 CCGCCG CCGCCGACGCCG 4: 141,874,762 probably benign Het
Enah GTGGCGGC G 1: 181,921,934 probably null Het
Entpd2 CTT CTTT 2: 25,400,895 probably null Het
Epha2 CCCCC CCCCCC 4: 141,323,406 unknown Het
Fam114a2 T C 11: 57,493,033 T359A probably benign Het
Farp1 A G 14: 121,237,148 I258V probably damaging Het
Fbxw28 G T 9: 109,338,526 Y54* probably null Het
Gabre CAGGCTCA C X: 72,270,177 probably null Het
Gm17660 A C 5: 104,074,859 probably null Het
Gprc5d A T 6: 135,116,519 L130Q probably damaging Het
H13 G A 2: 152,669,669 E30K probably damaging Het
Kif21b A T 1: 136,158,341 T817S probably damaging Het
Kl A C 5: 150,953,420 Y235S probably benign Het
Klk5 T A 7: 43,842,374 V20D possibly damaging Het
Krtap28-10 TCCCACA TCCCACACCCACA 1: 83,042,123 probably benign Het
Krtap28-10 CAC CACGACAGCCACAGCAAC 1: 83,042,252 probably benign Het
Lamc2 T A 1: 153,152,055 T208S possibly damaging Het
Map1a GCTCCAGCTCCA GCTCCAGCTCCAGCTCCAGCTCCAGCTCCATCTCCAGCTCCA 2: 121,306,307 probably benign Het
Map3k5 A T 10: 20,100,172 N804I probably damaging Het
Map6d1 G A 16: 20,241,000 T105I probably benign Het
Mbd1 TGTCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC TATCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC 18: 74,273,573 probably benign Het
Mbd1 GTCTTCGTCTGCATCTGCATCTGCATCT GTCT 18: 74,273,610 probably benign Het
Mkl1 TTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTG 15: 81,018,255 probably benign Het
Mrgprx1 A AGAC 7: 48,021,511 probably benign Het
Mroh2a C A 1: 88,242,485 L710M probably damaging Het
Msmb A G 14: 32,158,090 D79G probably damaging Het
Nab2 A T 10: 127,664,364 D286E probably benign Het
Nrxn1 G A 17: 90,362,876 R1144C probably damaging Het
Otog A T 7: 46,287,669 T1601S probably damaging Het
Pan2 G A 10: 128,315,535 E842K probably benign Het
Pcca C T 14: 122,684,898 T357I probably damaging Het
Pcnx C T 12: 81,917,727 P223S probably damaging Het
Prop1 A C 11: 50,951,130 Y150D possibly damaging Het
Prss56 T C 1: 87,187,170 L465P probably benign Het
Psip1 T C 4: 83,460,498 I353M probably damaging Het
Rapgef3 A C 15: 97,760,740 H170Q probably benign Het
Rasal2 A T 1: 157,147,790 S1150T probably damaging Het
Rtbdn C CAGCGGA 8: 84,956,179 probably benign Het
Sap30bp T A 11: 115,960,507 I135N probably damaging Het
Sbp ATG ATGCTGACAACAAAGCTG 17: 23,945,387 probably benign Het
Slc35e4 A T 11: 3,907,960 L215Q possibly damaging Het
Smarca2 CAGC CAGCCCAAGC 19: 26,631,020 probably benign Het
Surf4 A T 2: 26,922,167 I183N probably benign Het
Tcof1 CAG CAGAAG 18: 60,835,738 probably benign Het
Timm23 T A 14: 32,180,555 *210C probably null Het
Tnfaip8 ACACACACACACACACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC AC 18: 50,046,831 probably benign Het
Trim66 A T 7: 109,460,740 L813Q possibly damaging Het
Trip10 G A 17: 57,255,045 A224T probably benign Het
Ttn T C 2: 76,907,599 T4245A unknown Het
Ttn T A 2: 76,908,025 I4103F unknown Het
Ubn2 T A 6: 38,463,628 M313K probably damaging Het
Ubr5 T C 15: 38,028,652 N521S Het
Utp20 A T 10: 88,825,457 D29E probably damaging Het
Vmn2r60 T A 7: 42,140,939 V450E probably benign Het
Wdr66 GAGGAGGAAGAGGAGGAAGAGGAGGGGGAGAAGGAG GAGGAGGAAGAGGAGGAAGAGGAGGGGGAGAAGGAGGAAAAGGAGGAAGAGGAGGAAGAGGAGGGGGAGAAGGAG 5: 123,253,883 probably benign Het
Wdr66 GGAAGAGGAGGAAGAGGAGGGGGAGAAGGAG GGAAGAGGAGGAAGAGGAGGGGGAGAAGGAGGAAAAGGAGGAAGAGGAGGAAGAGGAGGGGGAGAAGGAG 5: 123,253,888 probably benign Het
Wdr66 GAAGAGGAGGAAGAGGAGGGGGAGAAGGAG GAAGAGGAGGAAGAGGAGGGGGAGAAGGAGGAAAAGGAGAAAGAGGAGGAAGAGGAGGGGGAGAAGGAG 5: 123,253,889 probably benign Het
Wnt6 A T 1: 74,782,821 D187V probably damaging Het
Zc3h14 T C 12: 98,758,861 C261R probably damaging Het
Zfp384 GCCCAGGC GCCCAGGCCCAGCCCCAGGC 6: 125,036,489 probably benign Het
Zfp395 C T 14: 65,385,425 S3F unknown Het
Zfp583 T A 7: 6,316,982 I344F probably damaging Het
Zfp599 A C 9: 22,253,884 V65G probably benign Het
Zfp808 T C 13: 62,171,299 V114A probably benign Het
Zfp933 G A 4: 147,826,441 H233Y probably damaging Het
Znrd1as CACCACCACCACCAC CACCACCACCACCACCACCACTACCACCACCACCAC 17: 36,965,057 probably benign Het
Other mutations in Herc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Herc2 APN 7 56124299 missense probably damaging 1.00
IGL00529:Herc2 APN 7 56157753 missense probably benign
IGL00548:Herc2 APN 7 56206565 missense probably benign 0.20
IGL00970:Herc2 APN 7 56181064 splice site probably benign
IGL01141:Herc2 APN 7 56212841 missense possibly damaging 0.47
IGL01147:Herc2 APN 7 56156949 missense probably benign 0.43
IGL01150:Herc2 APN 7 56181133 missense probably damaging 1.00
IGL01519:Herc2 APN 7 56103950 missense probably damaging 1.00
IGL01576:Herc2 APN 7 56226661 critical splice donor site probably null
IGL01626:Herc2 APN 7 56085142 missense probably benign 0.02
IGL01658:Herc2 APN 7 56159452 missense probably damaging 1.00
IGL01707:Herc2 APN 7 56165187 missense probably damaging 1.00
IGL01727:Herc2 APN 7 56137806 missense probably damaging 1.00
IGL01935:Herc2 APN 7 56153793 missense probably benign
IGL01969:Herc2 APN 7 56185831 splice site probably benign
IGL02074:Herc2 APN 7 56087444 splice site probably benign
IGL02261:Herc2 APN 7 56206744 missense probably damaging 0.99
IGL02339:Herc2 APN 7 56121722 missense probably benign 0.01
IGL02353:Herc2 APN 7 56114812 missense probably damaging 1.00
IGL02360:Herc2 APN 7 56114812 missense probably damaging 1.00
IGL02409:Herc2 APN 7 56220469 splice site probably null
IGL02528:Herc2 APN 7 56108893 splice site probably benign
IGL02571:Herc2 APN 7 56153386 missense probably damaging 1.00
IGL02578:Herc2 APN 7 56106535 splice site probably null
IGL02661:Herc2 APN 7 56113073 missense probably damaging 1.00
IGL02664:Herc2 APN 7 56135678 nonsense probably null
IGL02675:Herc2 APN 7 56164101 missense probably damaging 0.99
IGL02689:Herc2 APN 7 56165283 splice site probably benign
IGL02710:Herc2 APN 7 56137814 missense possibly damaging 0.95
IGL02750:Herc2 APN 7 56204379 splice site probably benign
IGL02754:Herc2 APN 7 56097498 missense probably damaging 1.00
IGL03029:Herc2 APN 7 56168967 missense probably damaging 1.00
IGL03039:Herc2 APN 7 56169021 splice site probably benign
IGL03082:Herc2 APN 7 56185923 missense probably benign 0.19
IGL03090:Herc2 APN 7 56204473 missense probably damaging 0.96
IGL03154:Herc2 APN 7 56202159 missense probably damaging 1.00
IGL03165:Herc2 APN 7 56191912 missense probably damaging 1.00
IGL03201:Herc2 APN 7 56219768 missense probably damaging 1.00
IGL03234:Herc2 APN 7 56103862 missense probably damaging 1.00
IGL03293:Herc2 APN 7 56155130 missense probably benign 0.43
IGL03331:Herc2 APN 7 56135267 splice site probably benign
IGL03340:Herc2 APN 7 56090920 missense possibly damaging 0.51
IGL03409:Herc2 APN 7 56228569 missense probably damaging 1.00
I0000:Herc2 UTSW 7 56136729 splice site probably benign
PIT1430001:Herc2 UTSW 7 56226954 missense probably damaging 1.00
R0009:Herc2 UTSW 7 56207812 missense probably benign 0.03
R0009:Herc2 UTSW 7 56207812 missense probably benign 0.03
R0058:Herc2 UTSW 7 56170483 missense possibly damaging 0.93
R0114:Herc2 UTSW 7 56153774 splice site probably benign
R0117:Herc2 UTSW 7 56213611 splice site probably benign
R0141:Herc2 UTSW 7 56121561 missense probably benign 0.17
R0266:Herc2 UTSW 7 56206578 missense probably damaging 1.00
R0401:Herc2 UTSW 7 56157732 missense probably damaging 0.99
R0403:Herc2 UTSW 7 56159417 missense probably damaging 1.00
R0437:Herc2 UTSW 7 56219815 nonsense probably null
R0491:Herc2 UTSW 7 56122366 missense possibly damaging 0.54
R0499:Herc2 UTSW 7 56184369 nonsense probably null
R0580:Herc2 UTSW 7 56138791 missense probably damaging 1.00
R0650:Herc2 UTSW 7 56113210 missense probably damaging 1.00
R0744:Herc2 UTSW 7 56206036 splice site probably benign
R0798:Herc2 UTSW 7 56135683 critical splice donor site probably null
R0842:Herc2 UTSW 7 56121705 missense probably benign
R0849:Herc2 UTSW 7 56206578 missense probably damaging 1.00
R0850:Herc2 UTSW 7 56204483 missense probably benign 0.09
R0926:Herc2 UTSW 7 56132548 missense possibly damaging 0.67
R1146:Herc2 UTSW 7 56146696 missense probably benign
R1146:Herc2 UTSW 7 56146696 missense probably benign
R1292:Herc2 UTSW 7 56197203 missense probably benign 0.05
R1370:Herc2 UTSW 7 56168873 missense probably benign 0.01
R1443:Herc2 UTSW 7 56204733 missense possibly damaging 0.69
R1445:Herc2 UTSW 7 56168996 missense probably damaging 1.00
R1541:Herc2 UTSW 7 56135657 missense probably damaging 1.00
R1550:Herc2 UTSW 7 56135658 missense probably damaging 1.00
R1551:Herc2 UTSW 7 56146669 missense probably benign 0.01
R1633:Herc2 UTSW 7 56229369 missense probably null 1.00
R1635:Herc2 UTSW 7 56136667 missense probably benign 0.00
R1659:Herc2 UTSW 7 56135105 missense probably benign 0.00
R1682:Herc2 UTSW 7 56088400 missense possibly damaging 0.87
R1697:Herc2 UTSW 7 56153905 missense probably benign 0.43
R1748:Herc2 UTSW 7 56148823 critical splice donor site probably null
R1802:Herc2 UTSW 7 56184332 missense probably damaging 1.00
R1835:Herc2 UTSW 7 56206765 nonsense probably null
R1836:Herc2 UTSW 7 56155105 nonsense probably null
R1872:Herc2 UTSW 7 56157509 missense probably benign 0.18
R1889:Herc2 UTSW 7 56189813 missense possibly damaging 0.60
R1906:Herc2 UTSW 7 56114864 missense probably benign 0.01
R2004:Herc2 UTSW 7 56137859 missense probably damaging 1.00
R2030:Herc2 UTSW 7 56184373 missense probably damaging 0.99
R2037:Herc2 UTSW 7 56205961 missense probably damaging 1.00
R2059:Herc2 UTSW 7 56163897 missense probably damaging 1.00
R2068:Herc2 UTSW 7 56132497 missense probably damaging 1.00
R2072:Herc2 UTSW 7 56226964 missense probably damaging 1.00
R2085:Herc2 UTSW 7 56212965 missense possibly damaging 0.94
R2115:Herc2 UTSW 7 56185828 splice site probably benign
R2160:Herc2 UTSW 7 56212922 missense probably benign 0.00
R2173:Herc2 UTSW 7 56185951 missense probably benign 0.27
R2221:Herc2 UTSW 7 56169018 critical splice donor site probably null
R2280:Herc2 UTSW 7 56137271 missense possibly damaging 0.79
R3078:Herc2 UTSW 7 56137243 missense probably benign
R3104:Herc2 UTSW 7 56135355 missense probably benign 0.23
R3177:Herc2 UTSW 7 56153428 missense probably benign 0.00
R3277:Herc2 UTSW 7 56153428 missense probably benign 0.00
R3766:Herc2 UTSW 7 56163824 missense probably damaging 1.00
R3770:Herc2 UTSW 7 56165007 missense probably benign
R3807:Herc2 UTSW 7 56207809 missense probably damaging 1.00
R3912:Herc2 UTSW 7 56098437 missense probably damaging 0.98
R4004:Herc2 UTSW 7 56106465 missense possibly damaging 0.53
R4039:Herc2 UTSW 7 56156411 missense probably damaging 0.98
R4190:Herc2 UTSW 7 56122448 missense probably benign 0.03
R4225:Herc2 UTSW 7 56164987 missense probably damaging 1.00
R4334:Herc2 UTSW 7 56226654 missense probably damaging 1.00
R4405:Herc2 UTSW 7 56170477 missense probably damaging 1.00
R4448:Herc2 UTSW 7 56227892 missense probably damaging 1.00
R4450:Herc2 UTSW 7 56227892 missense probably damaging 1.00
R4565:Herc2 UTSW 7 56153838 missense possibly damaging 0.71
R4667:Herc2 UTSW 7 56131253 missense probably damaging 1.00
R4747:Herc2 UTSW 7 56106393 missense possibly damaging 0.80
R4762:Herc2 UTSW 7 56170640 missense probably benign 0.19
R4829:Herc2 UTSW 7 56106492 missense probably benign 0.39
R4832:Herc2 UTSW 7 56098417 nonsense probably null
R4895:Herc2 UTSW 7 56222986 missense probably damaging 1.00
R4904:Herc2 UTSW 7 56157486 missense probably damaging 0.99
R4908:Herc2 UTSW 7 56177912 missense probably benign 0.01
R4911:Herc2 UTSW 7 56227892 missense probably damaging 1.00
R4921:Herc2 UTSW 7 56229690 missense probably benign 0.04
R4939:Herc2 UTSW 7 56206736 missense probably damaging 1.00
R5155:Herc2 UTSW 7 56227826 missense possibly damaging 0.85
R5184:Herc2 UTSW 7 56122351 missense probably damaging 1.00
R5269:Herc2 UTSW 7 56168870 nonsense probably null
R5306:Herc2 UTSW 7 56184961 missense probably damaging 1.00
R5314:Herc2 UTSW 7 56219786 missense probably damaging 0.99
R5369:Herc2 UTSW 7 56182700 missense probably damaging 1.00
R5418:Herc2 UTSW 7 56137565 missense probably damaging 1.00
R5420:Herc2 UTSW 7 56203830 missense probably damaging 0.96
R5463:Herc2 UTSW 7 56194262 missense probably damaging 1.00
R5510:Herc2 UTSW 7 56206771 missense probably damaging 1.00
R5634:Herc2 UTSW 7 56206783 missense probably damaging 1.00
R5638:Herc2 UTSW 7 56204416 missense probably benign 0.01
R5690:Herc2 UTSW 7 56157705 missense probably benign
R5762:Herc2 UTSW 7 56197190 missense possibly damaging 0.68
R5807:Herc2 UTSW 7 56230919 missense probably damaging 0.99
R5878:Herc2 UTSW 7 56124248 missense probably benign
R6036:Herc2 UTSW 7 56068053 missense probably benign 0.01
R6036:Herc2 UTSW 7 56068053 missense probably benign 0.01
R6083:Herc2 UTSW 7 56228505 missense probably benign 0.00
R6192:Herc2 UTSW 7 56207762 missense probably damaging 1.00
R6193:Herc2 UTSW 7 56156901 missense probably damaging 0.98
R6261:Herc2 UTSW 7 56197072 nonsense probably null
R6267:Herc2 UTSW 7 56153166 nonsense probably null
R6267:Herc2 UTSW 7 56204718 missense possibly damaging 0.51
R6298:Herc2 UTSW 7 56191265 missense probably benign
R6299:Herc2 UTSW 7 56135055 missense possibly damaging 0.86
R6326:Herc2 UTSW 7 56222934 missense probably damaging 0.98
R6347:Herc2 UTSW 7 56194403 critical splice donor site probably null
R6394:Herc2 UTSW 7 56215981 missense probably damaging 1.00
R6500:Herc2 UTSW 7 56146645 nonsense probably null
R6526:Herc2 UTSW 7 56157330 missense probably damaging 0.99
R6592:Herc2 UTSW 7 56207690 critical splice acceptor site probably null
R6619:Herc2 UTSW 7 56068092 nonsense probably null
R6719:Herc2 UTSW 7 56212826 missense probably damaging 1.00
R6750:Herc2 UTSW 7 56097447 missense probably damaging 1.00
R6807:Herc2 UTSW 7 56164922 missense probably damaging 1.00
R6811:Herc2 UTSW 7 56113433 nonsense probably null
R6837:Herc2 UTSW 7 56189841 missense possibly damaging 0.89
R6838:Herc2 UTSW 7 56108778 missense probably damaging 1.00
R6902:Herc2 UTSW 7 56135486 missense probably benign 0.37
R6983:Herc2 UTSW 7 56106453 missense possibly damaging 0.74
R6985:Herc2 UTSW 7 56106453 missense possibly damaging 0.74
R6985:Herc2 UTSW 7 56132480 missense probably damaging 1.00
R6986:Herc2 UTSW 7 56106453 missense possibly damaging 0.74
R6987:Herc2 UTSW 7 56106453 missense possibly damaging 0.74
R7113:Herc2 UTSW 7 56203849 missense probably damaging 0.99
R7173:Herc2 UTSW 7 56203827 missense probably damaging 1.00
R7202:Herc2 UTSW 7 56131286 missense probably damaging 0.99
R7205:Herc2 UTSW 7 56182640 missense probably damaging 1.00
R7236:Herc2 UTSW 7 56085080 missense probably benign 0.29
R7297:Herc2 UTSW 7 56136658 missense probably benign 0.00
R7358:Herc2 UTSW 7 56182675 missense possibly damaging 0.48
R7438:Herc2 UTSW 7 56103718 splice site probably null
R7537:Herc2 UTSW 7 56219779 nonsense probably null
R7578:Herc2 UTSW 7 56134800 missense probably benign 0.07
R7614:Herc2 UTSW 7 56153275 nonsense probably null
R7638:Herc2 UTSW 7 56157438 missense probably benign 0.26
R7638:Herc2 UTSW 7 56220525 missense probably damaging 1.00
R7646:Herc2 UTSW 7 56134613 missense probably benign
R7663:Herc2 UTSW 7 56136685 missense probably benign
R7665:Herc2 UTSW 7 56153155 missense probably damaging 1.00
R7691:Herc2 UTSW 7 56191845 missense probably benign
R7733:Herc2 UTSW 7 56188664 missense probably damaging 0.99
R7767:Herc2 UTSW 7 56228527 missense probably benign 0.39
R7802:Herc2 UTSW 7 56164090 missense probably damaging 1.00
R7847:Herc2 UTSW 7 56157560 critical splice donor site probably null
R7930:Herc2 UTSW 7 56157560 critical splice donor site probably null
R8003:Herc2 UTSW 7 56168904 missense possibly damaging 0.94
R8045:Herc2 UTSW 7 56184900 missense probably damaging 1.00
X0011:Herc2 UTSW 7 56131292 missense probably benign
X0023:Herc2 UTSW 7 56090918 missense possibly damaging 0.73
X0057:Herc2 UTSW 7 56229690 missense probably benign 0.04
X0064:Herc2 UTSW 7 56191211 missense probably benign 0.01
X0064:Herc2 UTSW 7 56191258 missense probably benign
Z1088:Herc2 UTSW 7 56087341 missense probably benign 0.00
Z1088:Herc2 UTSW 7 56131292 missense probably benign
Z1088:Herc2 UTSW 7 56215381 missense possibly damaging 0.86
Z1088:Herc2 UTSW 7 56215432 missense probably damaging 1.00
Z1088:Herc2 UTSW 7 56226589 missense probably damaging 1.00
Z1176:Herc2 UTSW 7 56097533 missense possibly damaging 0.48
Z1176:Herc2 UTSW 7 56131292 missense probably benign
Z1176:Herc2 UTSW 7 56132498 missense probably damaging 1.00
Z1177:Herc2 UTSW 7 56121589 missense possibly damaging 0.55
Z1177:Herc2 UTSW 7 56131292 missense probably benign
Predicted Primers PCR Primer
(F):5'- GAACCAAAGTGTGCATGAGC -3'
(R):5'- CATGTACTTGCTCAGCTTGC -3'

Sequencing Primer
(F):5'- CCAAAGTGTGCATGAGCTGTTAG -3'
(R):5'- AGCTTGCTATCCCCCAGG -3'
Posted On2019-12-04