Incidental Mutation 'RF024:Trim66'
ID 604061
Institutional Source Beutler Lab
Gene Symbol Trim66
Ensembl Gene ENSMUSG00000031026
Gene Name tripartite motif-containing 66
Synonyms Tif1d, D7H11orf29
Accession Numbers
Essential gene? Probably non essential (E-score: 0.155) question?
Stock # RF024 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 109048213-109107341 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 109059947 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 813 (L813Q)
Ref Sequence ENSEMBL: ENSMUSP00000102352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033339] [ENSMUST00000106739] [ENSMUST00000106741]
AlphaFold Q924W6
Predicted Effect possibly damaging
Transcript: ENSMUST00000033339
AA Change: L711Q

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000033339
Gene: ENSMUSG00000031026
AA Change: L711Q

DomainStartEndE-ValueType
PHD 4 69 7.77e0 SMART
BBC 108 234 1.61e-39 SMART
low complexity region 318 333 N/A INTRINSIC
low complexity region 452 486 N/A INTRINSIC
low complexity region 517 530 N/A INTRINSIC
low complexity region 568 581 N/A INTRINSIC
PHD 998 1041 4.09e-10 SMART
BROMO 1069 1175 8.22e-27 SMART
low complexity region 1185 1199 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106739
AA Change: L711Q

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102350
Gene: ENSMUSG00000031026
AA Change: L711Q

DomainStartEndE-ValueType
PHD 4 69 7.77e0 SMART
BBC 108 234 1.61e-39 SMART
low complexity region 318 333 N/A INTRINSIC
low complexity region 452 486 N/A INTRINSIC
low complexity region 517 530 N/A INTRINSIC
low complexity region 568 581 N/A INTRINSIC
PHD 998 1041 4.09e-10 SMART
BROMO 1069 1175 8.22e-27 SMART
low complexity region 1185 1199 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106741
AA Change: L813Q

PolyPhen 2 Score 0.616 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000102352
Gene: ENSMUSG00000031026
AA Change: L813Q

DomainStartEndE-ValueType
RING 28 78 2.38e-2 SMART
BBOX 102 140 1.48e0 SMART
PHD 106 171 7.77e0 SMART
RING 107 170 4.38e0 SMART
BBOX 162 203 4.21e-3 SMART
BBC 210 336 1.61e-39 SMART
low complexity region 420 435 N/A INTRINSIC
low complexity region 554 588 N/A INTRINSIC
low complexity region 619 632 N/A INTRINSIC
low complexity region 670 683 N/A INTRINSIC
PHD 1100 1143 4.09e-10 SMART
BROMO 1171 1277 8.22e-27 SMART
low complexity region 1287 1301 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.3%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 G T 4: 53,049,125 (GRCm39) T1651N probably damaging Het
Abca17 T TACCTG 17: 24,506,706 (GRCm39) probably null Het
Adgra3 A T 5: 50,170,729 (GRCm39) probably null Het
Ank1 T A 8: 23,609,360 (GRCm39) F1380I probably benign Het
Apcs A T 1: 172,721,809 (GRCm39) M179K probably damaging Het
Asb7 C T 7: 66,297,631 (GRCm39) R287Q probably damaging Het
Begain G GCCGCCT 12: 108,999,363 (GRCm39) probably null Het
Cacna2d1 A G 5: 16,230,774 (GRCm39) T69A possibly damaging Het
Ccdc170 CCA CCAACA 10: 4,511,024 (GRCm39) probably benign Het
Ccdc69 A G 11: 54,951,349 (GRCm39) L24P probably damaging Het
Cdh16 T G 8: 105,343,684 (GRCm39) N604T probably damaging Het
Cfap251 GAGGAGGAAGAGGAGGAAGAGGAGGGGGAGAAGGAG GAGGAGGAAGAGGAGGAAGAGGAGGGGGAGAAGGAGGAAAAGGAGGAAGAGGAGGAAGAGGAGGGGGAGAAGGAG 5: 123,391,946 (GRCm39) probably benign Het
Cfap251 GAAGAGGAGGAAGAGGAGGGGGAGAAGGAG GAAGAGGAGGAAGAGGAGGGGGAGAAGGAGGAAAAGGAGAAAGAGGAGGAAGAGGAGGGGGAGAAGGAG 5: 123,391,952 (GRCm39) probably benign Het
Cfap251 GGAAGAGGAGGAAGAGGAGGGGGAGAAGGAG GGAAGAGGAGGAAGAGGAGGGGGAGAAGGAGGAAAAGGAGGAAGAGGAGGAAGAGGAGGGGGAGAAGGAG 5: 123,391,951 (GRCm39) probably benign Het
Crybg1 A G 10: 43,880,741 (GRCm39) V149A probably benign Het
Cyb5r4 ACACTGCCCAGGGA ACACTGCCCAGGGATGTGACAGACGCACTGCCCAGGGA 9: 86,922,488 (GRCm39) probably benign Het
Dnmt1 ACCTCGTT ACCTCGTTTTGGGGGCGGAGCACAGTTCCTCCCTCGTT 9: 20,821,434 (GRCm39) probably benign Het
Dnmt1 CAGTTCCTACCTCGTT CAGTTCCTACCTCGTTTTGGGGGCGGAGCAAAGTTCCTACCTCGTT 9: 20,821,426 (GRCm39) probably null Het
Efhd2 CCGCCG CCGCCGACGCCG 4: 141,602,073 (GRCm39) probably benign Het
Enah GTGGCGGC G 1: 181,749,499 (GRCm39) probably null Het
Entpd2 CTT CTTT 2: 25,290,907 (GRCm39) probably null Het
Epha2 CCCCC CCCCCC 4: 141,050,717 (GRCm39) unknown Het
Fam114a2 T C 11: 57,383,859 (GRCm39) T359A probably benign Het
Farp1 A G 14: 121,474,560 (GRCm39) I258V probably damaging Het
Fbxw28 G T 9: 109,167,594 (GRCm39) Y54* probably null Het
Gabre CAGGCTCA C X: 71,313,783 (GRCm39) probably null Het
Gprc5d A T 6: 135,093,517 (GRCm39) L130Q probably damaging Het
H13 G A 2: 152,511,589 (GRCm39) E30K probably damaging Het
Herc2 C T 7: 55,876,273 (GRCm39) R4429C probably damaging Het
Kif21b A T 1: 136,086,079 (GRCm39) T817S probably damaging Het
Kl A C 5: 150,876,885 (GRCm39) Y235S probably benign Het
Klk1b5 T A 7: 43,491,798 (GRCm39) V20D possibly damaging Het
Krtap28-10 TCCCACA TCCCACACCCACA 1: 83,019,844 (GRCm39) probably benign Het
Krtap28-10 CAC CACGACAGCCACAGCAAC 1: 83,019,973 (GRCm39) probably benign Het
Lamc2 T A 1: 153,027,801 (GRCm39) T208S possibly damaging Het
Map1a GCTCCAGCTCCA GCTCCAGCTCCAGCTCCAGCTCCAGCTCCATCTCCAGCTCCA 2: 121,136,788 (GRCm39) probably benign Het
Map3k5 A T 10: 19,975,918 (GRCm39) N804I probably damaging Het
Map6d1 G A 16: 20,059,750 (GRCm39) T105I probably benign Het
Mbd1 TGTCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC TATCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC 18: 74,406,644 (GRCm39) probably benign Het
Mbd1 GTCTTCGTCTGCATCTGCATCTGCATCT GTCT 18: 74,406,681 (GRCm39) probably benign Het
Mrgprx1 A AGAC 7: 47,671,259 (GRCm39) probably benign Het
Mroh2a C A 1: 88,170,207 (GRCm39) L710M probably damaging Het
Mrtfa TTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTG 15: 80,902,456 (GRCm39) probably benign Het
Msmb A G 14: 31,880,047 (GRCm39) D79G probably damaging Het
Nab2 A T 10: 127,500,233 (GRCm39) D286E probably benign Het
Nrxn1 G A 17: 90,670,304 (GRCm39) R1144C probably damaging Het
Otog A T 7: 45,937,093 (GRCm39) T1601S probably damaging Het
Pan2 G A 10: 128,151,404 (GRCm39) E842K probably benign Het
Pcca C T 14: 122,922,310 (GRCm39) T357I probably damaging Het
Pcnx1 C T 12: 81,964,501 (GRCm39) P223S probably damaging Het
Polr1has CACCACCACCACCAC CACCACCACCACCACCACCACTACCACCACCACCAC 17: 37,275,949 (GRCm39) probably benign Het
Prop1 A C 11: 50,841,957 (GRCm39) Y150D possibly damaging Het
Prss56 T C 1: 87,114,892 (GRCm39) L465P probably benign Het
Psip1 T C 4: 83,378,735 (GRCm39) I353M probably damaging Het
Rapgef3 A C 15: 97,658,621 (GRCm39) H170Q probably benign Het
Rasal2 A T 1: 156,975,360 (GRCm39) S1150T probably damaging Het
Rtbdn C CAGCGGA 8: 85,682,808 (GRCm39) probably benign Het
Sap30bp T A 11: 115,851,333 (GRCm39) I135N probably damaging Het
Sbp ATG ATGCTGACAACAAAGCTG 17: 24,164,361 (GRCm39) probably benign Het
Scpppq1 A C 5: 104,222,725 (GRCm39) probably null Het
Slc35e4 A T 11: 3,857,960 (GRCm39) L215Q possibly damaging Het
Slc6a20b A T 9: 123,427,407 (GRCm39) probably benign Het
Smarca2 CAGC CAGCCCAAGC 19: 26,608,420 (GRCm39) probably benign Het
Surf4 A T 2: 26,812,179 (GRCm39) I183N probably benign Het
Tcof1 CAG CAGAAG 18: 60,968,810 (GRCm39) probably benign Het
Timm23 T A 14: 31,902,512 (GRCm39) *210C probably null Het
Tnfaip8 ACACACACACACACACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC AC 18: 50,179,898 (GRCm39) probably benign Het
Trip10 G A 17: 57,562,045 (GRCm39) A224T probably benign Het
Ttn T A 2: 76,738,369 (GRCm39) I4103F unknown Het
Ttn T C 2: 76,737,943 (GRCm39) T4245A unknown Het
Ubn2 T A 6: 38,440,563 (GRCm39) M313K probably damaging Het
Ubr5 T C 15: 38,028,896 (GRCm39) N521S Het
Utp20 A T 10: 88,661,319 (GRCm39) D29E probably damaging Het
Vmn2r60 T A 7: 41,790,363 (GRCm39) V450E probably benign Het
Wnt6 A T 1: 74,821,980 (GRCm39) D187V probably damaging Het
Zc3h14 T C 12: 98,725,120 (GRCm39) C261R probably damaging Het
Zfp384 GCCCAGGC GCCCAGGCCCAGCCCCAGGC 6: 125,013,452 (GRCm39) probably benign Het
Zfp395 C T 14: 65,622,874 (GRCm39) S3F unknown Het
Zfp583 T A 7: 6,319,981 (GRCm39) I344F probably damaging Het
Zfp599 A C 9: 22,165,180 (GRCm39) V65G probably benign Het
Zfp808 T C 13: 62,319,113 (GRCm39) V114A probably benign Het
Zfp933 G A 4: 147,910,898 (GRCm39) H233Y probably damaging Het
Other mutations in Trim66
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01539:Trim66 APN 7 109,054,273 (GRCm39) missense probably benign 0.02
IGL01758:Trim66 APN 7 109,085,252 (GRCm39) critical splice donor site probably null
IGL01982:Trim66 APN 7 109,057,970 (GRCm39) missense probably benign 0.00
IGL01983:Trim66 APN 7 109,057,458 (GRCm39) nonsense probably null
IGL02149:Trim66 APN 7 109,060,109 (GRCm39) missense possibly damaging 0.66
IGL02392:Trim66 APN 7 109,059,481 (GRCm39) missense probably benign 0.01
IGL02483:Trim66 APN 7 109,076,837 (GRCm39) splice site probably benign
IGL02832:Trim66 APN 7 109,059,704 (GRCm39) missense probably damaging 1.00
IGL02945:Trim66 APN 7 109,059,383 (GRCm39) nonsense probably null
IGL03085:Trim66 APN 7 109,057,952 (GRCm39) missense probably benign 0.17
PIT1430001:Trim66 UTSW 7 109,074,454 (GRCm39) missense probably damaging 0.99
R0326:Trim66 UTSW 7 109,059,379 (GRCm39) missense probably benign 0.00
R0358:Trim66 UTSW 7 109,059,383 (GRCm39) nonsense probably null
R0401:Trim66 UTSW 7 109,074,471 (GRCm39) missense probably damaging 0.98
R0470:Trim66 UTSW 7 109,056,749 (GRCm39) splice site probably benign
R0568:Trim66 UTSW 7 109,059,902 (GRCm39) missense probably benign 0.00
R0669:Trim66 UTSW 7 109,054,199 (GRCm39) intron probably benign
R0980:Trim66 UTSW 7 109,054,877 (GRCm39) missense probably damaging 1.00
R1015:Trim66 UTSW 7 109,054,440 (GRCm39) missense probably damaging 1.00
R1078:Trim66 UTSW 7 109,071,526 (GRCm39) missense probably damaging 1.00
R1099:Trim66 UTSW 7 109,074,661 (GRCm39) missense probably benign 0.34
R1181:Trim66 UTSW 7 109,083,784 (GRCm39) critical splice donor site probably null
R1497:Trim66 UTSW 7 109,083,826 (GRCm39) missense probably benign 0.00
R1583:Trim66 UTSW 7 109,054,287 (GRCm39) missense probably damaging 1.00
R1843:Trim66 UTSW 7 109,075,046 (GRCm39) missense probably damaging 0.99
R1998:Trim66 UTSW 7 109,083,784 (GRCm39) critical splice donor site probably null
R2016:Trim66 UTSW 7 109,071,439 (GRCm39) critical splice donor site probably null
R2143:Trim66 UTSW 7 109,074,320 (GRCm39) missense probably damaging 0.98
R2144:Trim66 UTSW 7 109,074,320 (GRCm39) missense probably damaging 0.98
R2145:Trim66 UTSW 7 109,074,320 (GRCm39) missense probably damaging 0.98
R3945:Trim66 UTSW 7 109,071,475 (GRCm39) missense possibly damaging 0.94
R4012:Trim66 UTSW 7 109,057,338 (GRCm39) missense probably damaging 0.98
R4464:Trim66 UTSW 7 109,076,897 (GRCm39) missense possibly damaging 0.51
R4473:Trim66 UTSW 7 109,081,202 (GRCm39) missense probably damaging 1.00
R4729:Trim66 UTSW 7 109,055,267 (GRCm39) critical splice donor site probably null
R4730:Trim66 UTSW 7 109,082,276 (GRCm39) missense probably damaging 1.00
R4775:Trim66 UTSW 7 109,056,796 (GRCm39) nonsense probably null
R4819:Trim66 UTSW 7 109,056,793 (GRCm39) missense probably damaging 1.00
R5269:Trim66 UTSW 7 109,056,797 (GRCm39) missense probably benign 0.00
R5557:Trim66 UTSW 7 109,082,944 (GRCm39) missense probably benign 0.06
R5832:Trim66 UTSW 7 109,054,409 (GRCm39) missense probably damaging 1.00
R6220:Trim66 UTSW 7 109,082,300 (GRCm39) missense probably damaging 0.97
R6243:Trim66 UTSW 7 109,059,481 (GRCm39) missense probably benign 0.01
R6374:Trim66 UTSW 7 109,085,269 (GRCm39) missense probably benign
R6450:Trim66 UTSW 7 109,059,945 (GRCm39) missense probably benign 0.09
R6543:Trim66 UTSW 7 109,075,086 (GRCm39) missense probably benign 0.01
R6788:Trim66 UTSW 7 109,076,961 (GRCm39) missense probably damaging 1.00
R6842:Trim66 UTSW 7 109,059,983 (GRCm39) missense probably benign 0.00
R7169:Trim66 UTSW 7 109,054,328 (GRCm39) missense probably benign 0.25
R7257:Trim66 UTSW 7 109,059,451 (GRCm39) missense probably damaging 1.00
R7328:Trim66 UTSW 7 109,056,958 (GRCm39) missense probably damaging 0.99
R7616:Trim66 UTSW 7 109,082,956 (GRCm39) missense probably damaging 0.99
R8423:Trim66 UTSW 7 109,074,599 (GRCm39) missense possibly damaging 0.77
R8855:Trim66 UTSW 7 109,081,188 (GRCm39) missense probably damaging 1.00
R9130:Trim66 UTSW 7 109,076,896 (GRCm39) missense possibly damaging 0.90
R9137:Trim66 UTSW 7 109,074,330 (GRCm39) missense probably damaging 0.99
R9640:Trim66 UTSW 7 109,074,825 (GRCm39) missense probably damaging 1.00
RF013:Trim66 UTSW 7 109,059,960 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTACACAAGGCATTCCCCAG -3'
(R):5'- CACAGATACACAGGGTGAGC -3'

Sequencing Primer
(F):5'- TGGTACCCAGGCTTTCTGCAG -3'
(R):5'- GGTGAGCAGCCTGACAG -3'
Posted On 2019-12-04