Incidental Mutation 'RF024:Rtbdn'
ID604063
Institutional Source Beutler Lab
Gene Symbol Rtbdn
Ensembl Gene ENSMUSG00000048617
Gene Nameretbindin
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF024 (G1)
Quality Score214.465
Status Not validated
Chromosome8
Chromosomal Location84946991-84956603 bp(+) (GRCm38)
Type of Mutationsmall insertion (2 aa in frame mutation)
DNA Base Change (assembly) C to CAGCGGA at 84956179 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065049] [ENSMUST00000067472] [ENSMUST00000109736] [ENSMUST00000109738] [ENSMUST00000109740] [ENSMUST00000121880] [ENSMUST00000128972] [ENSMUST00000147812] [ENSMUST00000152378]
Predicted Effect probably benign
Transcript: ENSMUST00000065049
SMART Domains Protein: ENSMUSP00000066769
Gene: ENSMUSG00000052926

DomainStartEndE-ValueType
Pfam:RNase_HII 31 242 7.1e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000067472
SMART Domains Protein: ENSMUSP00000070558
Gene: ENSMUSG00000048617

DomainStartEndE-ValueType
Pfam:Folate_rec 27 203 2e-40 PFAM
low complexity region 224 234 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109736
SMART Domains Protein: ENSMUSP00000105358
Gene: ENSMUSG00000052926

DomainStartEndE-ValueType
Pfam:RNase_HII 31 242 1.3e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109738
SMART Domains Protein: ENSMUSP00000105360
Gene: ENSMUSG00000052926

DomainStartEndE-ValueType
Pfam:RNase_HII 31 242 5.5e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109740
SMART Domains Protein: ENSMUSP00000105362
Gene: ENSMUSG00000048617

DomainStartEndE-ValueType
Pfam:Folate_rec 27 203 3.5e-42 PFAM
low complexity region 224 234 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121880
SMART Domains Protein: ENSMUSP00000113982
Gene: ENSMUSG00000048617

DomainStartEndE-ValueType
Pfam:Folate_rec 27 203 3.5e-42 PFAM
low complexity region 224 234 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128972
SMART Domains Protein: ENSMUSP00000121864
Gene: ENSMUSG00000052926

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:RNase_HII 57 268 1.4e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147812
SMART Domains Protein: ENSMUSP00000120374
Gene: ENSMUSG00000052926

DomainStartEndE-ValueType
Pfam:RNase_HII 31 242 1.3e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152378
SMART Domains Protein: ENSMUSP00000132841
Gene: ENSMUSG00000048617

DomainStartEndE-ValueType
Pfam:Folate_rec 2 172 2.8e-38 PFAM
low complexity region 193 203 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was first identified in a study of human eye tissues. The protein encoded by this gene is preferentially expressed in the retina and may play a role in binding retinoids and other carotenoids as it shares homology with riboflavin binding proteins. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 G T 4: 53,049,125 T1651N probably damaging Het
Abca17 T TACCTG 17: 24,287,732 probably null Het
Ank1 T A 8: 23,119,344 F1380I probably benign Het
Apcs A T 1: 172,894,242 M179K probably damaging Het
Asb7 C T 7: 66,647,883 R287Q probably damaging Het
Begain G GCCGCCT 12: 109,033,437 probably null Het
Cacna2d1 A G 5: 16,025,776 T69A possibly damaging Het
Ccdc170 CCA CCAACA 10: 4,561,024 probably benign Het
Ccdc69 A G 11: 55,060,523 L24P probably damaging Het
Cdh16 T G 8: 104,617,052 N604T probably damaging Het
Crybg1 A G 10: 44,004,745 V149A probably benign Het
Cyb5r4 ACACTGCCCAGGGA ACACTGCCCAGGGATGTGACAGACGCACTGCCCAGGGA 9: 87,040,435 probably benign Het
Dnmt1 CAGTTCCTACCTCGTT CAGTTCCTACCTCGTTTTGGGGGCGGAGCAAAGTTCCTACCTCGTT 9: 20,910,130 probably null Het
Dnmt1 ACCTCGTT ACCTCGTTTTGGGGGCGGAGCACAGTTCCTCCCTCGTT 9: 20,910,138 probably benign Het
Efhd2 CCGCCG CCGCCGACGCCG 4: 141,874,762 probably benign Het
Enah GTGGCGGC G 1: 181,921,934 probably null Het
Entpd2 CTT CTTT 2: 25,400,895 probably null Het
Epha2 CCCCC CCCCCC 4: 141,323,406 unknown Het
Fam114a2 T C 11: 57,493,033 T359A probably benign Het
Farp1 A G 14: 121,237,148 I258V probably damaging Het
Fbxw28 G T 9: 109,338,526 Y54* probably null Het
Gabre CAGGCTCA C X: 72,270,177 probably null Het
Gm17660 A C 5: 104,074,859 probably null Het
Gprc5d A T 6: 135,116,519 L130Q probably damaging Het
H13 G A 2: 152,669,669 E30K probably damaging Het
Herc2 C T 7: 56,226,525 R4429C probably damaging Het
Kif21b A T 1: 136,158,341 T817S probably damaging Het
Kl A C 5: 150,953,420 Y235S probably benign Het
Klk5 T A 7: 43,842,374 V20D possibly damaging Het
Krtap28-10 TCCCACA TCCCACACCCACA 1: 83,042,123 probably benign Het
Krtap28-10 CAC CACGACAGCCACAGCAAC 1: 83,042,252 probably benign Het
Lamc2 T A 1: 153,152,055 T208S possibly damaging Het
Map1a GCTCCAGCTCCA GCTCCAGCTCCAGCTCCAGCTCCAGCTCCATCTCCAGCTCCA 2: 121,306,307 probably benign Het
Map3k5 A T 10: 20,100,172 N804I probably damaging Het
Map6d1 G A 16: 20,241,000 T105I probably benign Het
Mbd1 TGTCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC TATCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC 18: 74,273,573 probably benign Het
Mbd1 GTCTTCGTCTGCATCTGCATCTGCATCT GTCT 18: 74,273,610 probably benign Het
Mkl1 TTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTG 15: 81,018,255 probably benign Het
Mrgprx1 A AGAC 7: 48,021,511 probably benign Het
Mroh2a C A 1: 88,242,485 L710M probably damaging Het
Msmb A G 14: 32,158,090 D79G probably damaging Het
Nab2 A T 10: 127,664,364 D286E probably benign Het
Nrxn1 G A 17: 90,362,876 R1144C probably damaging Het
Otog A T 7: 46,287,669 T1601S probably damaging Het
Pan2 G A 10: 128,315,535 E842K probably benign Het
Pcca C T 14: 122,684,898 T357I probably damaging Het
Pcnx C T 12: 81,917,727 P223S probably damaging Het
Prop1 A C 11: 50,951,130 Y150D possibly damaging Het
Prss56 T C 1: 87,187,170 L465P probably benign Het
Psip1 T C 4: 83,460,498 I353M probably damaging Het
Rapgef3 A C 15: 97,760,740 H170Q probably benign Het
Rasal2 A T 1: 157,147,790 S1150T probably damaging Het
Sap30bp T A 11: 115,960,507 I135N probably damaging Het
Sbp ATG ATGCTGACAACAAAGCTG 17: 23,945,387 probably benign Het
Slc35e4 A T 11: 3,907,960 L215Q possibly damaging Het
Smarca2 CAGC CAGCCCAAGC 19: 26,631,020 probably benign Het
Surf4 A T 2: 26,922,167 I183N probably benign Het
Tcof1 CAG CAGAAG 18: 60,835,738 probably benign Het
Timm23 T A 14: 32,180,555 *210C probably null Het
Tnfaip8 ACACACACACACACACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC AC 18: 50,046,831 probably benign Het
Trim66 A T 7: 109,460,740 L813Q possibly damaging Het
Trip10 G A 17: 57,255,045 A224T probably benign Het
Ttn T C 2: 76,907,599 T4245A unknown Het
Ttn T A 2: 76,908,025 I4103F unknown Het
Ubn2 T A 6: 38,463,628 M313K probably damaging Het
Ubr5 T C 15: 38,028,652 N521S Het
Utp20 A T 10: 88,825,457 D29E probably damaging Het
Vmn2r60 T A 7: 42,140,939 V450E probably benign Het
Wdr66 GAGGAGGAAGAGGAGGAAGAGGAGGGGGAGAAGGAG GAGGAGGAAGAGGAGGAAGAGGAGGGGGAGAAGGAGGAAAAGGAGGAAGAGGAGGAAGAGGAGGGGGAGAAGGAG 5: 123,253,883 probably benign Het
Wdr66 GGAAGAGGAGGAAGAGGAGGGGGAGAAGGAG GGAAGAGGAGGAAGAGGAGGGGGAGAAGGAGGAAAAGGAGGAAGAGGAGGAAGAGGAGGGGGAGAAGGAG 5: 123,253,888 probably benign Het
Wdr66 GAAGAGGAGGAAGAGGAGGGGGAGAAGGAG GAAGAGGAGGAAGAGGAGGGGGAGAAGGAGGAAAAGGAGAAAGAGGAGGAAGAGGAGGGGGAGAAGGAG 5: 123,253,889 probably benign Het
Wnt6 A T 1: 74,782,821 D187V probably damaging Het
Zc3h14 T C 12: 98,758,861 C261R probably damaging Het
Zfp384 GCCCAGGC GCCCAGGCCCAGCCCCAGGC 6: 125,036,489 probably benign Het
Zfp395 C T 14: 65,385,425 S3F unknown Het
Zfp583 T A 7: 6,316,982 I344F probably damaging Het
Zfp599 A C 9: 22,253,884 V65G probably benign Het
Zfp808 T C 13: 62,171,299 V114A probably benign Het
Zfp933 G A 4: 147,826,441 H233Y probably damaging Het
Znrd1as CACCACCACCACCAC CACCACCACCACCACCACCACTACCACCACCACCAC 17: 36,965,057 probably benign Het
Other mutations in Rtbdn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02892:Rtbdn APN 8 84955089 missense probably damaging 1.00
IGL03192:Rtbdn APN 8 84952655 missense probably benign 0.32
FR4342:Rtbdn UTSW 8 84956168 small insertion probably benign
FR4342:Rtbdn UTSW 8 84956178 small insertion probably benign
FR4589:Rtbdn UTSW 8 84956171 small insertion probably benign
FR4737:Rtbdn UTSW 8 84956161 small insertion probably benign
FR4737:Rtbdn UTSW 8 84956168 small insertion probably benign
FR4737:Rtbdn UTSW 8 84956176 small insertion probably benign
FR4737:Rtbdn UTSW 8 84956177 small insertion probably benign
R1581:Rtbdn UTSW 8 84955066 missense probably benign 0.01
R5057:Rtbdn UTSW 8 84955009 missense probably damaging 1.00
R6788:Rtbdn UTSW 8 84952674 missense probably null 1.00
R7570:Rtbdn UTSW 8 84952927 missense probably damaging 1.00
RF023:Rtbdn UTSW 8 84956166 small insertion probably benign
RF025:Rtbdn UTSW 8 84956175 small insertion probably benign
RF034:Rtbdn UTSW 8 84956175 small insertion probably benign
RF046:Rtbdn UTSW 8 84956179 small insertion probably benign
RF050:Rtbdn UTSW 8 84956170 small insertion probably benign
RF056:Rtbdn UTSW 8 84956170 small insertion probably benign
RF056:Rtbdn UTSW 8 84956172 small insertion probably benign
RF057:Rtbdn UTSW 8 84956166 small insertion probably benign
RF058:Rtbdn UTSW 8 84956172 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- GGCCATACCTAGTCCAGAAGAC -3'
(R):5'- TCCCCAGGTGTTTTCCCAAG -3'

Sequencing Primer
(F):5'- AGCCCAGAGACTCAGGTTC -3'
(R):5'- AGGTGTTTTCCCAAGCAGCAG -3'
Posted On2019-12-04