Incidental Mutation 'RF024:Zfp599'
ID604067
Institutional Source Beutler Lab
Gene Symbol Zfp599
Ensembl Gene ENSMUSG00000062794
Gene Namezinc finger protein 599
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #RF024 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location22247430-22259895 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 22253884 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 65 (V65G)
Ref Sequence ENSEMBL: ENSMUSP00000083462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086281]
Predicted Effect probably benign
Transcript: ENSMUST00000086281
AA Change: V65G

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000083462
Gene: ENSMUSG00000062794
AA Change: V65G

DomainStartEndE-ValueType
KRAB 4 64 5.35e-33 SMART
ZnF_C2H2 228 250 5.59e-4 SMART
ZnF_C2H2 256 278 2.43e-4 SMART
ZnF_C2H2 284 306 1.69e-3 SMART
ZnF_C2H2 312 334 8.94e-3 SMART
ZnF_C2H2 340 362 8.47e-4 SMART
ZnF_C2H2 368 390 5.06e-2 SMART
ZnF_C2H2 396 418 7.9e-4 SMART
ZnF_C2H2 424 446 7.67e-2 SMART
ZnF_C2H2 452 474 1.64e-1 SMART
ZnF_C2H2 480 503 7.37e-4 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 G T 4: 53,049,125 T1651N probably damaging Het
Abca17 T TACCTG 17: 24,287,732 probably null Het
Ank1 T A 8: 23,119,344 F1380I probably benign Het
Apcs A T 1: 172,894,242 M179K probably damaging Het
Asb7 C T 7: 66,647,883 R287Q probably damaging Het
Begain G GCCGCCT 12: 109,033,437 probably null Het
Cacna2d1 A G 5: 16,025,776 T69A possibly damaging Het
Ccdc170 CCA CCAACA 10: 4,561,024 probably benign Het
Ccdc69 A G 11: 55,060,523 L24P probably damaging Het
Cdh16 T G 8: 104,617,052 N604T probably damaging Het
Crybg1 A G 10: 44,004,745 V149A probably benign Het
Cyb5r4 ACACTGCCCAGGGA ACACTGCCCAGGGATGTGACAGACGCACTGCCCAGGGA 9: 87,040,435 probably benign Het
Dnmt1 CAGTTCCTACCTCGTT CAGTTCCTACCTCGTTTTGGGGGCGGAGCAAAGTTCCTACCTCGTT 9: 20,910,130 probably null Het
Dnmt1 ACCTCGTT ACCTCGTTTTGGGGGCGGAGCACAGTTCCTCCCTCGTT 9: 20,910,138 probably benign Het
Efhd2 CCGCCG CCGCCGACGCCG 4: 141,874,762 probably benign Het
Enah GTGGCGGC G 1: 181,921,934 probably null Het
Entpd2 CTT CTTT 2: 25,400,895 probably null Het
Epha2 CCCCC CCCCCC 4: 141,323,406 unknown Het
Fam114a2 T C 11: 57,493,033 T359A probably benign Het
Farp1 A G 14: 121,237,148 I258V probably damaging Het
Fbxw28 G T 9: 109,338,526 Y54* probably null Het
Gabre CAGGCTCA C X: 72,270,177 probably null Het
Gm17660 A C 5: 104,074,859 probably null Het
Gprc5d A T 6: 135,116,519 L130Q probably damaging Het
H13 G A 2: 152,669,669 E30K probably damaging Het
Herc2 C T 7: 56,226,525 R4429C probably damaging Het
Kif21b A T 1: 136,158,341 T817S probably damaging Het
Kl A C 5: 150,953,420 Y235S probably benign Het
Klk5 T A 7: 43,842,374 V20D possibly damaging Het
Krtap28-10 TCCCACA TCCCACACCCACA 1: 83,042,123 probably benign Het
Krtap28-10 CAC CACGACAGCCACAGCAAC 1: 83,042,252 probably benign Het
Lamc2 T A 1: 153,152,055 T208S possibly damaging Het
Map1a GCTCCAGCTCCA GCTCCAGCTCCAGCTCCAGCTCCAGCTCCATCTCCAGCTCCA 2: 121,306,307 probably benign Het
Map3k5 A T 10: 20,100,172 N804I probably damaging Het
Map6d1 G A 16: 20,241,000 T105I probably benign Het
Mbd1 TGTCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC TATCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC 18: 74,273,573 probably benign Het
Mbd1 GTCTTCGTCTGCATCTGCATCTGCATCT GTCT 18: 74,273,610 probably benign Het
Mkl1 TTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTG 15: 81,018,255 probably benign Het
Mrgprx1 A AGAC 7: 48,021,511 probably benign Het
Mroh2a C A 1: 88,242,485 L710M probably damaging Het
Msmb A G 14: 32,158,090 D79G probably damaging Het
Nab2 A T 10: 127,664,364 D286E probably benign Het
Nrxn1 G A 17: 90,362,876 R1144C probably damaging Het
Otog A T 7: 46,287,669 T1601S probably damaging Het
Pan2 G A 10: 128,315,535 E842K probably benign Het
Pcca C T 14: 122,684,898 T357I probably damaging Het
Pcnx C T 12: 81,917,727 P223S probably damaging Het
Prop1 A C 11: 50,951,130 Y150D possibly damaging Het
Prss56 T C 1: 87,187,170 L465P probably benign Het
Psip1 T C 4: 83,460,498 I353M probably damaging Het
Rapgef3 A C 15: 97,760,740 H170Q probably benign Het
Rasal2 A T 1: 157,147,790 S1150T probably damaging Het
Rtbdn C CAGCGGA 8: 84,956,179 probably benign Het
Sap30bp T A 11: 115,960,507 I135N probably damaging Het
Sbp ATG ATGCTGACAACAAAGCTG 17: 23,945,387 probably benign Het
Slc35e4 A T 11: 3,907,960 L215Q possibly damaging Het
Smarca2 CAGC CAGCCCAAGC 19: 26,631,020 probably benign Het
Surf4 A T 2: 26,922,167 I183N probably benign Het
Tcof1 CAG CAGAAG 18: 60,835,738 probably benign Het
Timm23 T A 14: 32,180,555 *210C probably null Het
Tnfaip8 ACACACACACACACACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC AC 18: 50,046,831 probably benign Het
Trim66 A T 7: 109,460,740 L813Q possibly damaging Het
Trip10 G A 17: 57,255,045 A224T probably benign Het
Ttn T C 2: 76,907,599 T4245A unknown Het
Ttn T A 2: 76,908,025 I4103F unknown Het
Ubn2 T A 6: 38,463,628 M313K probably damaging Het
Ubr5 T C 15: 38,028,652 N521S Het
Utp20 A T 10: 88,825,457 D29E probably damaging Het
Vmn2r60 T A 7: 42,140,939 V450E probably benign Het
Wdr66 GAGGAGGAAGAGGAGGAAGAGGAGGGGGAGAAGGAG GAGGAGGAAGAGGAGGAAGAGGAGGGGGAGAAGGAGGAAAAGGAGGAAGAGGAGGAAGAGGAGGGGGAGAAGGAG 5: 123,253,883 probably benign Het
Wdr66 GGAAGAGGAGGAAGAGGAGGGGGAGAAGGAG GGAAGAGGAGGAAGAGGAGGGGGAGAAGGAGGAAAAGGAGGAAGAGGAGGAAGAGGAGGGGGAGAAGGAG 5: 123,253,888 probably benign Het
Wdr66 GAAGAGGAGGAAGAGGAGGGGGAGAAGGAG GAAGAGGAGGAAGAGGAGGGGGAGAAGGAGGAAAAGGAGAAAGAGGAGGAAGAGGAGGGGGAGAAGGAG 5: 123,253,889 probably benign Het
Wnt6 A T 1: 74,782,821 D187V probably damaging Het
Zc3h14 T C 12: 98,758,861 C261R probably damaging Het
Zfp384 GCCCAGGC GCCCAGGCCCAGCCCCAGGC 6: 125,036,489 probably benign Het
Zfp395 C T 14: 65,385,425 S3F unknown Het
Zfp583 T A 7: 6,316,982 I344F probably damaging Het
Zfp808 T C 13: 62,171,299 V114A probably benign Het
Zfp933 G A 4: 147,826,441 H233Y probably damaging Het
Znrd1as CACCACCACCACCAC CACCACCACCACCACCACCACTACCACCACCACCAC 17: 36,965,057 probably benign Het
Other mutations in Zfp599
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Zfp599 APN 9 22249472 missense possibly damaging 0.94
IGL00845:Zfp599 APN 9 22251518 splice site probably benign
R0136:Zfp599 UTSW 9 22249742 missense probably benign 0.13
R0239:Zfp599 UTSW 9 22249759 missense probably damaging 1.00
R0239:Zfp599 UTSW 9 22249759 missense probably damaging 1.00
R0421:Zfp599 UTSW 9 22250547 splice site probably benign
R1699:Zfp599 UTSW 9 22250404 missense probably benign 0.20
R1723:Zfp599 UTSW 9 22258065 missense probably damaging 1.00
R1899:Zfp599 UTSW 9 22251549 missense probably benign 0.00
R4231:Zfp599 UTSW 9 22249745 nonsense probably null
R4233:Zfp599 UTSW 9 22249745 nonsense probably null
R4236:Zfp599 UTSW 9 22249745 nonsense probably null
R4931:Zfp599 UTSW 9 22258123 missense probably damaging 0.98
R5117:Zfp599 UTSW 9 22250100 nonsense probably null
R5615:Zfp599 UTSW 9 22253869 missense probably benign
R5759:Zfp599 UTSW 9 22249661 missense probably damaging 1.00
R5915:Zfp599 UTSW 9 22249834 missense probably damaging 1.00
R6184:Zfp599 UTSW 9 22249651 missense probably benign 0.18
R6188:Zfp599 UTSW 9 22249990 missense probably damaging 1.00
R6657:Zfp599 UTSW 9 22250242 missense probably damaging 1.00
R6736:Zfp599 UTSW 9 22249844 missense probably damaging 1.00
R6752:Zfp599 UTSW 9 22249544 missense probably damaging 1.00
R7071:Zfp599 UTSW 9 22258096 missense probably benign 0.38
R7643:Zfp599 UTSW 9 22249892 missense probably benign 0.19
R7714:Zfp599 UTSW 9 22250515 missense probably benign 0.07
R8014:Zfp599 UTSW 9 22249481 missense probably benign 0.03
RF005:Zfp599 UTSW 9 22253884 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTCTCCTTCCATCTTAAGAGGC -3'
(R):5'- CGCCACCAAAGGTTTCTAATC -3'

Sequencing Primer
(F):5'- GAACACTCTCTTCATTCATGTCAATG -3'
(R):5'- TCCTGATCACAGCAGCGATTATG -3'
Posted On2019-12-04