Incidental Mutation 'RF024:Map3k5'
Institutional Source Beutler Lab
Gene Symbol Map3k5
Ensembl Gene ENSMUSG00000071369
Gene Namemitogen-activated protein kinase kinase kinase 5
SynonymsASK, ASK1, 7420452D20Rik, Mekk5
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF024 (G1)
Quality Score225.009
Status Validated
Chromosomal Location19934472-20142753 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 20100172 bp
Amino Acid Change Asparagine to Isoleucine at position 804 (N804I)
Ref Sequence ENSEMBL: ENSMUSP00000093485 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095806] [ENSMUST00000120259] [ENSMUST00000129437]
Predicted Effect probably damaging
Transcript: ENSMUST00000095806
AA Change: N804I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000093485
Gene: ENSMUSG00000071369
AA Change: N804I

low complexity region 26 43 N/A INTRINSIC
low complexity region 44 58 N/A INTRINSIC
low complexity region 80 99 N/A INTRINSIC
Pfam:DUF4071 172 552 2.1e-162 PFAM
S_TKc 687 945 8.08e-92 SMART
low complexity region 1195 1207 N/A INTRINSIC
low complexity region 1225 1238 N/A INTRINSIC
coiled coil region 1251 1292 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120259
AA Change: N796I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112864
Gene: ENSMUSG00000071369
AA Change: N796I

low complexity region 26 43 N/A INTRINSIC
low complexity region 44 58 N/A INTRINSIC
low complexity region 80 99 N/A INTRINSIC
Pfam:DUF4071 172 544 1.7e-156 PFAM
S_TKc 679 937 8.08e-92 SMART
low complexity region 1187 1199 N/A INTRINSIC
low complexity region 1217 1230 N/A INTRINSIC
coiled coil region 1243 1284 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129437
SMART Domains Protein: ENSMUSP00000114518
Gene: ENSMUSG00000071369

Pfam:Pkinase 34 144 7.6e-20 PFAM
Pfam:Pkinase_Tyr 34 144 5e-14 PFAM
Predicted Effect
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.3%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitogen-activated protein kinase (MAPK) signaling cascades include MAPK or extracellular signal-regulated kinase (ERK), MAPK kinase (MKK or MEK), and MAPK kinase kinase (MAPKKK or MEKK). MAPKK kinase/MEKK phosphorylates and activates its downstream protein kinase, MAPK kinase/MEK, which in turn activates MAPK. The kinases of these signaling cascades are highly conserved, and homologs exist in yeast, Drosophila, and mammalian cells. MAPKKK5 contains 1,374 amino acids with all 11 kinase subdomains. Northern blot analysis shows that MAPKKK5 transcript is abundantly expressed in human heart and pancreas. The MAPKKK5 protein phosphorylates and activates MKK4 (aliases SERK1, MAPKK4) in vitro, and activates c-Jun N-terminal kinase (JNK)/stress-activated protein kinase (SAPK) during transient expression in COS and 293 cells; MAPKKK5 does not activate MAPK/ERK. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are overtly normal, however apoptosis abnormalities are evident in cultured cells and after induced heart damage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 G T 4: 53,049,125 T1651N probably damaging Het
Abca17 T TACCTG 17: 24,287,732 probably null Het
Adgra3 A T 5: 50,013,387 probably null Het
Ank1 T A 8: 23,119,344 F1380I probably benign Het
Apcs A T 1: 172,894,242 M179K probably damaging Het
Asb7 C T 7: 66,647,883 R287Q probably damaging Het
Begain G GCCGCCT 12: 109,033,437 probably null Het
Cacna2d1 A G 5: 16,025,776 T69A possibly damaging Het
Ccdc170 CCA CCAACA 10: 4,561,024 probably benign Het
Ccdc69 A G 11: 55,060,523 L24P probably damaging Het
Cdh16 T G 8: 104,617,052 N604T probably damaging Het
Crybg1 A G 10: 44,004,745 V149A probably benign Het
Efhd2 CCGCCG CCGCCGACGCCG 4: 141,874,762 probably benign Het
Enah GTGGCGGC G 1: 181,921,934 probably null Het
Entpd2 CTT CTTT 2: 25,400,895 probably null Het
Epha2 CCCCC CCCCCC 4: 141,323,406 unknown Het
Fam114a2 T C 11: 57,493,033 T359A probably benign Het
Farp1 A G 14: 121,237,148 I258V probably damaging Het
Fbxw28 G T 9: 109,338,526 Y54* probably null Het
Gabre CAGGCTCA C X: 72,270,177 probably null Het
Gm17660 A C 5: 104,074,859 probably null Het
Gprc5d A T 6: 135,116,519 L130Q probably damaging Het
H13 G A 2: 152,669,669 E30K probably damaging Het
Herc2 C T 7: 56,226,525 R4429C probably damaging Het
Kif21b A T 1: 136,158,341 T817S probably damaging Het
Kl A C 5: 150,953,420 Y235S probably benign Het
Klk5 T A 7: 43,842,374 V20D possibly damaging Het
Krtap28-10 TCCCACA TCCCACACCCACA 1: 83,042,123 probably benign Het
Krtap28-10 CAC CACGACAGCCACAGCAAC 1: 83,042,252 probably benign Het
Lamc2 T A 1: 153,152,055 T208S possibly damaging Het
Map6d1 G A 16: 20,241,000 T105I probably benign Het
Mbd1 GTCTTCGTCTGCATCTGCATCTGCATCT GTCT 18: 74,273,610 probably benign Het
Mrgprx1 A AGAC 7: 48,021,511 probably benign Het
Mroh2a C A 1: 88,242,485 L710M probably damaging Het
Msmb A G 14: 32,158,090 D79G probably damaging Het
Nab2 A T 10: 127,664,364 D286E probably benign Het
Nrxn1 G A 17: 90,362,876 R1144C probably damaging Het
Otog A T 7: 46,287,669 T1601S probably damaging Het
Pan2 G A 10: 128,315,535 E842K probably benign Het
Pcca C T 14: 122,684,898 T357I probably damaging Het
Pcnx C T 12: 81,917,727 P223S probably damaging Het
Prop1 A C 11: 50,951,130 Y150D possibly damaging Het
Prss56 T C 1: 87,187,170 L465P probably benign Het
Psip1 T C 4: 83,460,498 I353M probably damaging Het
Rapgef3 A C 15: 97,760,740 H170Q probably benign Het
Rasal2 A T 1: 157,147,790 S1150T probably damaging Het
Rtbdn C CAGCGGA 8: 84,956,179 probably benign Het
Sap30bp T A 11: 115,960,507 I135N probably damaging Het
Sbp ATG ATGCTGACAACAAAGCTG 17: 23,945,387 probably benign Het
Slc35e4 A T 11: 3,907,960 L215Q possibly damaging Het
Slc6a20b A T 9: 123,598,342 probably benign Het
Smarca2 CAGC CAGCCCAAGC 19: 26,631,020 probably benign Het
Surf4 A T 2: 26,922,167 I183N probably benign Het
Tcof1 CAG CAGAAG 18: 60,835,738 probably benign Het
Timm23 T A 14: 32,180,555 *210C probably null Het
Trim66 A T 7: 109,460,740 L813Q possibly damaging Het
Trip10 G A 17: 57,255,045 A224T probably benign Het
Ttn T C 2: 76,907,599 T4245A unknown Het
Ttn T A 2: 76,908,025 I4103F unknown Het
Ubn2 T A 6: 38,463,628 M313K probably damaging Het
Ubr5 T C 15: 38,028,652 N521S Het
Utp20 A T 10: 88,825,457 D29E probably damaging Het
Vmn2r60 T A 7: 42,140,939 V450E probably benign Het
Wnt6 A T 1: 74,782,821 D187V probably damaging Het
Zc3h14 T C 12: 98,758,861 C261R probably damaging Het
Zfp384 GCCCAGGC GCCCAGGCCCAGCCCCAGGC 6: 125,036,489 probably benign Het
Zfp395 C T 14: 65,385,425 S3F unknown Het
Zfp583 T A 7: 6,316,982 I344F probably damaging Het
Zfp599 A C 9: 22,253,884 V65G probably benign Het
Zfp808 T C 13: 62,171,299 V114A probably benign Het
Zfp933 G A 4: 147,826,441 H233Y probably damaging Het
Other mutations in Map3k5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Map3k5 APN 10 19935044 missense possibly damaging 0.73
IGL00978:Map3k5 APN 10 20141567 missense probably damaging 1.00
IGL01470:Map3k5 APN 10 20118187 missense possibly damaging 0.89
IGL01992:Map3k5 APN 10 20029133 nonsense probably null
IGL02479:Map3k5 APN 10 20056484 missense probably damaging 1.00
IGL02728:Map3k5 APN 10 20118292 missense possibly damaging 0.71
IGL02812:Map3k5 APN 10 20025036 missense probably damaging 1.00
IGL03104:Map3k5 APN 10 20132055 missense probably benign
P0033:Map3k5 UTSW 10 20132213 splice site probably benign
PIT4434001:Map3k5 UTSW 10 20026257 missense probably damaging 0.98
R0284:Map3k5 UTSW 10 20000613 missense probably damaging 0.99
R1103:Map3k5 UTSW 10 20023676 missense probably benign 0.00
R1172:Map3k5 UTSW 10 20056648 intron probably benign
R1250:Map3k5 UTSW 10 20110775 missense possibly damaging 0.73
R1493:Map3k5 UTSW 10 20029113 missense probably damaging 1.00
R1634:Map3k5 UTSW 10 20136911 missense possibly damaging 0.64
R1693:Map3k5 UTSW 10 20104242 missense probably damaging 1.00
R1713:Map3k5 UTSW 10 20110847 missense possibly damaging 0.79
R1832:Map3k5 UTSW 10 20099560 missense probably damaging 1.00
R1844:Map3k5 UTSW 10 20104163 missense probably benign 0.33
R1869:Map3k5 UTSW 10 20132109 nonsense probably null
R2156:Map3k5 UTSW 10 20024937 missense probably damaging 1.00
R2214:Map3k5 UTSW 10 20026289 critical splice donor site probably null
R2221:Map3k5 UTSW 10 20067920 missense possibly damaging 0.96
R2223:Map3k5 UTSW 10 20067920 missense possibly damaging 0.96
R2249:Map3k5 UTSW 10 20127697 missense probably damaging 0.99
R2418:Map3k5 UTSW 10 20110857 missense probably benign 0.02
R2513:Map3k5 UTSW 10 20094455 missense possibly damaging 0.92
R3014:Map3k5 UTSW 10 20094429 missense probably damaging 1.00
R3770:Map3k5 UTSW 10 20025019 missense probably damaging 0.99
R3814:Map3k5 UTSW 10 20026190 missense probably damaging 0.99
R3814:Map3k5 UTSW 10 20140680 missense probably damaging 0.99
R4706:Map3k5 UTSW 10 20058938 missense probably damaging 1.00
R4749:Map3k5 UTSW 10 20132052 missense probably benign 0.42
R4903:Map3k5 UTSW 10 20118489 missense probably null 1.00
R4958:Map3k5 UTSW 10 20023789 missense possibly damaging 0.79
R5065:Map3k5 UTSW 10 20082467 missense probably damaging 1.00
R5210:Map3k5 UTSW 10 20024901 missense possibly damaging 0.82
R5245:Map3k5 UTSW 10 20140691 missense probably benign 0.00
R5304:Map3k5 UTSW 10 20108238 missense probably benign 0.13
R5428:Map3k5 UTSW 10 20023653 missense possibly damaging 0.93
R5566:Map3k5 UTSW 10 20110719 missense probably damaging 1.00
R5914:Map3k5 UTSW 10 20104255 missense probably benign 0.24
R6155:Map3k5 UTSW 10 20118441 missense probably benign 0.01
R6161:Map3k5 UTSW 10 20000575 missense probably damaging 0.98
R6191:Map3k5 UTSW 10 20023669 missense probably damaging 0.99
R6251:Map3k5 UTSW 10 20138260 splice site probably null
R6800:Map3k5 UTSW 10 20141580 makesense probably null
R7304:Map3k5 UTSW 10 20099555 missense probably damaging 1.00
R7722:Map3k5 UTSW 10 20132145 missense probably benign 0.04
R8058:Map3k5 UTSW 10 20132114 missense probably damaging 0.99
R8207:Map3k5 UTSW 10 20110866 frame shift probably null
X0017:Map3k5 UTSW 10 20118434 missense probably damaging 0.98
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-12-04