Incidental Mutation 'RF024:Crybg1'
ID604072
Institutional Source Beutler Lab
Gene Symbol Crybg1
Ensembl Gene ENSMUSG00000019866
Gene Namecrystallin beta-gamma domain containing 1
SynonymsAim1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF024 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location43950636-44148853 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44004745 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 149 (V149A)
Ref Sequence ENSEMBL: ENSMUSP00000143429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020017] [ENSMUST00000200401]
Predicted Effect probably benign
Transcript: ENSMUST00000020017
SMART Domains Protein: ENSMUSP00000020017
Gene: ENSMUSG00000019866

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
low complexity region 114 121 N/A INTRINSIC
low complexity region 176 192 N/A INTRINSIC
low complexity region 436 453 N/A INTRINSIC
low complexity region 507 518 N/A INTRINSIC
low complexity region 544 557 N/A INTRINSIC
low complexity region 837 857 N/A INTRINSIC
XTALbg 995 1078 8.57e-9 SMART
XTALbg 1094 1175 4.73e-20 SMART
XTALbg 1189 1282 1.23e-32 SMART
XTALbg 1290 1373 9.3e-28 SMART
XTALbg 1386 1465 1.66e-24 SMART
XTALbg 1473 1553 5.29e-32 SMART
RICIN 1556 1689 5.86e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200401
AA Change: V149A

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000143429
Gene: ENSMUSG00000019866
AA Change: V149A

DomainStartEndE-ValueType
low complexity region 377 390 N/A INTRINSIC
low complexity region 488 495 N/A INTRINSIC
low complexity region 550 566 N/A INTRINSIC
low complexity region 810 827 N/A INTRINSIC
low complexity region 881 892 N/A INTRINSIC
low complexity region 918 931 N/A INTRINSIC
low complexity region 1211 1231 N/A INTRINSIC
XTALbg 1369 1452 5.4e-11 SMART
XTALbg 1468 1549 2.9e-22 SMART
XTALbg 1563 1656 7.9e-35 SMART
XTALbg 1664 1747 6e-30 SMART
XTALbg 1760 1839 1.1e-26 SMART
XTALbg 1847 1927 3.3e-34 SMART
RICIN 1930 2063 3.3e-17 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 G T 4: 53,049,125 T1651N probably damaging Het
Abca17 T TACCTG 17: 24,287,732 probably null Het
Ank1 T A 8: 23,119,344 F1380I probably benign Het
Apcs A T 1: 172,894,242 M179K probably damaging Het
Asb7 C T 7: 66,647,883 R287Q probably damaging Het
Begain G GCCGCCT 12: 109,033,437 probably null Het
Cacna2d1 A G 5: 16,025,776 T69A possibly damaging Het
Ccdc170 CCA CCAACA 10: 4,561,024 probably benign Het
Ccdc69 A G 11: 55,060,523 L24P probably damaging Het
Cdh16 T G 8: 104,617,052 N604T probably damaging Het
Cyb5r4 ACACTGCCCAGGGA ACACTGCCCAGGGATGTGACAGACGCACTGCCCAGGGA 9: 87,040,435 probably benign Het
Dnmt1 CAGTTCCTACCTCGTT CAGTTCCTACCTCGTTTTGGGGGCGGAGCAAAGTTCCTACCTCGTT 9: 20,910,130 probably null Het
Dnmt1 ACCTCGTT ACCTCGTTTTGGGGGCGGAGCACAGTTCCTCCCTCGTT 9: 20,910,138 probably benign Het
Efhd2 CCGCCG CCGCCGACGCCG 4: 141,874,762 probably benign Het
Enah GTGGCGGC G 1: 181,921,934 probably null Het
Entpd2 CTT CTTT 2: 25,400,895 probably null Het
Epha2 CCCCC CCCCCC 4: 141,323,406 unknown Het
Fam114a2 T C 11: 57,493,033 T359A probably benign Het
Farp1 A G 14: 121,237,148 I258V probably damaging Het
Fbxw28 G T 9: 109,338,526 Y54* probably null Het
Gabre CAGGCTCA C X: 72,270,177 probably null Het
Gm17660 A C 5: 104,074,859 probably null Het
Gprc5d A T 6: 135,116,519 L130Q probably damaging Het
H13 G A 2: 152,669,669 E30K probably damaging Het
Herc2 C T 7: 56,226,525 R4429C probably damaging Het
Kif21b A T 1: 136,158,341 T817S probably damaging Het
Kl A C 5: 150,953,420 Y235S probably benign Het
Klk5 T A 7: 43,842,374 V20D possibly damaging Het
Krtap28-10 TCCCACA TCCCACACCCACA 1: 83,042,123 probably benign Het
Krtap28-10 CAC CACGACAGCCACAGCAAC 1: 83,042,252 probably benign Het
Lamc2 T A 1: 153,152,055 T208S possibly damaging Het
Map1a GCTCCAGCTCCA GCTCCAGCTCCAGCTCCAGCTCCAGCTCCATCTCCAGCTCCA 2: 121,306,307 probably benign Het
Map3k5 A T 10: 20,100,172 N804I probably damaging Het
Map6d1 G A 16: 20,241,000 T105I probably benign Het
Mbd1 TGTCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC TATCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC 18: 74,273,573 probably benign Het
Mbd1 GTCTTCGTCTGCATCTGCATCTGCATCT GTCT 18: 74,273,610 probably benign Het
Mkl1 TTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTG 15: 81,018,255 probably benign Het
Mrgprx1 A AGAC 7: 48,021,511 probably benign Het
Mroh2a C A 1: 88,242,485 L710M probably damaging Het
Msmb A G 14: 32,158,090 D79G probably damaging Het
Nab2 A T 10: 127,664,364 D286E probably benign Het
Nrxn1 G A 17: 90,362,876 R1144C probably damaging Het
Otog A T 7: 46,287,669 T1601S probably damaging Het
Pan2 G A 10: 128,315,535 E842K probably benign Het
Pcca C T 14: 122,684,898 T357I probably damaging Het
Pcnx C T 12: 81,917,727 P223S probably damaging Het
Prop1 A C 11: 50,951,130 Y150D possibly damaging Het
Prss56 T C 1: 87,187,170 L465P probably benign Het
Psip1 T C 4: 83,460,498 I353M probably damaging Het
Rapgef3 A C 15: 97,760,740 H170Q probably benign Het
Rasal2 A T 1: 157,147,790 S1150T probably damaging Het
Rtbdn C CAGCGGA 8: 84,956,179 probably benign Het
Sap30bp T A 11: 115,960,507 I135N probably damaging Het
Sbp ATG ATGCTGACAACAAAGCTG 17: 23,945,387 probably benign Het
Slc35e4 A T 11: 3,907,960 L215Q possibly damaging Het
Smarca2 CAGC CAGCCCAAGC 19: 26,631,020 probably benign Het
Surf4 A T 2: 26,922,167 I183N probably benign Het
Tcof1 CAG CAGAAG 18: 60,835,738 probably benign Het
Timm23 T A 14: 32,180,555 *210C probably null Het
Tnfaip8 ACACACACACACACACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC AC 18: 50,046,831 probably benign Het
Trim66 A T 7: 109,460,740 L813Q possibly damaging Het
Trip10 G A 17: 57,255,045 A224T probably benign Het
Ttn T C 2: 76,907,599 T4245A unknown Het
Ttn T A 2: 76,908,025 I4103F unknown Het
Ubn2 T A 6: 38,463,628 M313K probably damaging Het
Ubr5 T C 15: 38,028,652 N521S Het
Utp20 A T 10: 88,825,457 D29E probably damaging Het
Vmn2r60 T A 7: 42,140,939 V450E probably benign Het
Wdr66 GAGGAGGAAGAGGAGGAAGAGGAGGGGGAGAAGGAG GAGGAGGAAGAGGAGGAAGAGGAGGGGGAGAAGGAGGAAAAGGAGGAAGAGGAGGAAGAGGAGGGGGAGAAGGAG 5: 123,253,883 probably benign Het
Wdr66 GGAAGAGGAGGAAGAGGAGGGGGAGAAGGAG GGAAGAGGAGGAAGAGGAGGGGGAGAAGGAGGAAAAGGAGGAAGAGGAGGAAGAGGAGGGGGAGAAGGAG 5: 123,253,888 probably benign Het
Wdr66 GAAGAGGAGGAAGAGGAGGGGGAGAAGGAG GAAGAGGAGGAAGAGGAGGGGGAGAAGGAGGAAAAGGAGAAAGAGGAGGAAGAGGAGGGGGAGAAGGAG 5: 123,253,889 probably benign Het
Wnt6 A T 1: 74,782,821 D187V probably damaging Het
Zc3h14 T C 12: 98,758,861 C261R probably damaging Het
Zfp384 GCCCAGGC GCCCAGGCCCAGCCCCAGGC 6: 125,036,489 probably benign Het
Zfp395 C T 14: 65,385,425 S3F unknown Het
Zfp583 T A 7: 6,316,982 I344F probably damaging Het
Zfp599 A C 9: 22,253,884 V65G probably benign Het
Zfp808 T C 13: 62,171,299 V114A probably benign Het
Zfp933 G A 4: 147,826,441 H233Y probably damaging Het
Znrd1as CACCACCACCACCAC CACCACCACCACCACCACCACTACCACCACCACCAC 17: 36,965,057 probably benign Het
Other mutations in Crybg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Crybg1 APN 10 43992509 missense probably damaging 1.00
IGL00502:Crybg1 APN 10 43958313 missense probably damaging 1.00
IGL00848:Crybg1 APN 10 43967818 splice site probably null
IGL01287:Crybg1 APN 10 43992494 missense possibly damaging 0.53
IGL01310:Crybg1 APN 10 43975058 missense possibly damaging 0.95
IGL01310:Crybg1 APN 10 44003600 missense probably damaging 0.99
IGL02683:Crybg1 APN 10 43989216 missense possibly damaging 0.64
IGL03095:Crybg1 APN 10 43989249 missense probably damaging 1.00
R0062:Crybg1 UTSW 10 43997906 missense probably damaging 0.98
R0142:Crybg1 UTSW 10 43999063 missense possibly damaging 0.83
R0294:Crybg1 UTSW 10 43986376 missense probably damaging 1.00
R0539:Crybg1 UTSW 10 43998898 missense probably benign 0.03
R0781:Crybg1 UTSW 10 43999093 missense possibly damaging 0.95
R1110:Crybg1 UTSW 10 43999093 missense possibly damaging 0.95
R1189:Crybg1 UTSW 10 43998794 missense probably damaging 1.00
R1428:Crybg1 UTSW 10 43975078 missense probably benign 0.33
R1521:Crybg1 UTSW 10 43998416 missense probably damaging 1.00
R1688:Crybg1 UTSW 10 43973798 missense probably damaging 1.00
R1728:Crybg1 UTSW 10 44004019 missense probably damaging 0.97
R1756:Crybg1 UTSW 10 43986279 missense probably damaging 1.00
R1773:Crybg1 UTSW 10 43992548 missense possibly damaging 0.91
R1784:Crybg1 UTSW 10 44004019 missense probably damaging 0.97
R1850:Crybg1 UTSW 10 43997674 missense probably damaging 1.00
R1911:Crybg1 UTSW 10 43997677 missense possibly damaging 0.47
R1920:Crybg1 UTSW 10 43997548 missense probably damaging 1.00
R1964:Crybg1 UTSW 10 43958330 missense probably damaging 1.00
R2298:Crybg1 UTSW 10 43999222 missense probably damaging 1.00
R3617:Crybg1 UTSW 10 43956786 missense possibly damaging 0.82
R3913:Crybg1 UTSW 10 43998763 missense possibly damaging 0.95
R4081:Crybg1 UTSW 10 43975039 missense probably damaging 1.00
R4116:Crybg1 UTSW 10 43999162 missense possibly damaging 0.91
R4409:Crybg1 UTSW 10 43998758 missense possibly damaging 0.94
R4583:Crybg1 UTSW 10 43997620 missense probably damaging 1.00
R4721:Crybg1 UTSW 10 43997887 missense probably damaging 1.00
R4818:Crybg1 UTSW 10 43998587 missense probably benign 0.00
R4859:Crybg1 UTSW 10 43992569 missense probably damaging 1.00
R4933:Crybg1 UTSW 10 43999213 missense probably damaging 1.00
R5028:Crybg1 UTSW 10 43998212 missense possibly damaging 0.74
R5057:Crybg1 UTSW 10 43989108 nonsense probably null
R5102:Crybg1 UTSW 10 43997836 missense probably damaging 1.00
R5103:Crybg1 UTSW 10 43997948 missense probably damaging 1.00
R5137:Crybg1 UTSW 10 43958336 missense probably damaging 1.00
R5212:Crybg1 UTSW 10 43967743 missense possibly damaging 0.95
R5307:Crybg1 UTSW 10 44003714 missense probably benign 0.00
R5353:Crybg1 UTSW 10 43973665 missense probably damaging 1.00
R5463:Crybg1 UTSW 10 44003693 nonsense probably null
R5503:Crybg1 UTSW 10 43998766 missense probably benign 0.00
R5583:Crybg1 UTSW 10 44003510 missense probably benign 0.01
R5835:Crybg1 UTSW 10 43975133 missense probably benign 0.28
R6021:Crybg1 UTSW 10 43997538 missense probably damaging 1.00
R6032:Crybg1 UTSW 10 43956760 missense probably damaging 1.00
R6032:Crybg1 UTSW 10 43956760 missense probably damaging 1.00
R6277:Crybg1 UTSW 10 43997259 missense probably benign 0.03
R6338:Crybg1 UTSW 10 43992509 missense probably damaging 1.00
R6348:Crybg1 UTSW 10 44003951 missense probably damaging 1.00
R6514:Crybg1 UTSW 10 43997215 missense probably damaging 1.00
R6785:Crybg1 UTSW 10 43999171 missense probably benign 0.00
R6804:Crybg1 UTSW 10 43966341 missense probably damaging 1.00
R6938:Crybg1 UTSW 10 43997383 missense probably benign 0.01
R6983:Crybg1 UTSW 10 43999342 missense probably damaging 1.00
R7002:Crybg1 UTSW 10 43998835 missense probably damaging 1.00
R7153:Crybg1 UTSW 10 43964666 missense possibly damaging 0.64
R7271:Crybg1 UTSW 10 43997623 nonsense probably null
R7293:Crybg1 UTSW 10 44003432 missense probably damaging 1.00
R7304:Crybg1 UTSW 10 43997258 missense probably benign 0.05
R7313:Crybg1 UTSW 10 43989111 missense probably damaging 0.98
R7373:Crybg1 UTSW 10 44004140 missense probably benign 0.00
R7449:Crybg1 UTSW 10 44004519 missense probably benign
R7530:Crybg1 UTSW 10 43999073 missense possibly damaging 0.62
R7660:Crybg1 UTSW 10 43998835 missense probably damaging 0.97
R7701:Crybg1 UTSW 10 43989143 missense probably benign 0.06
RF005:Crybg1 UTSW 10 44004745 missense probably benign 0.03
X0065:Crybg1 UTSW 10 43992526 synonymous silent
Z1088:Crybg1 UTSW 10 43997311 missense probably benign
Predicted Primers PCR Primer
(F):5'- AACCCCTACATTGATGCTGG -3'
(R):5'- GGTTCGCAGTAGCTTTGTAACC -3'

Sequencing Primer
(F):5'- CTGGAGCAAGGTGACTGTTC -3'
(R):5'- GCAGTAGCTTTGTAACCTACCAAAG -3'
Posted On2019-12-04