Incidental Mutation 'RF024:Pcnx'
ID604081
Institutional Source Beutler Lab
Gene Symbol Pcnx
Ensembl Gene ENSMUSG00000021140
Gene Namepecanex homolog
Synonyms3526401J03Rik, 2900024E21Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF024 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location81860023-82000924 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 81917727 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 223 (P223S)
Ref Sequence ENSEMBL: ENSMUSP00000021567 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021567] [ENSMUST00000221721] [ENSMUST00000222005]
Predicted Effect probably damaging
Transcript: ENSMUST00000021567
AA Change: P223S

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000021567
Gene: ENSMUSG00000021140
AA Change: P223S

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 52 74 N/A INTRINSIC
low complexity region 369 390 N/A INTRINSIC
low complexity region 407 422 N/A INTRINSIC
low complexity region 509 525 N/A INTRINSIC
low complexity region 616 638 N/A INTRINSIC
low complexity region 672 692 N/A INTRINSIC
low complexity region 764 783 N/A INTRINSIC
low complexity region 817 835 N/A INTRINSIC
low complexity region 842 853 N/A INTRINSIC
low complexity region 911 922 N/A INTRINSIC
transmembrane domain 1006 1028 N/A INTRINSIC
transmembrane domain 1035 1052 N/A INTRINSIC
transmembrane domain 1070 1092 N/A INTRINSIC
transmembrane domain 1113 1135 N/A INTRINSIC
transmembrane domain 1163 1185 N/A INTRINSIC
transmembrane domain 1197 1216 N/A INTRINSIC
transmembrane domain 1269 1291 N/A INTRINSIC
transmembrane domain 1298 1315 N/A INTRINSIC
Pfam:Pecanex_C 1785 2011 1.6e-118 PFAM
low complexity region 2125 2140 N/A INTRINSIC
low complexity region 2195 2202 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000221675
Predicted Effect probably damaging
Transcript: ENSMUST00000221721
AA Change: P223S

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000222005
AA Change: P223S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an evolutionarily conserved transmembrane protein similar to the pecanex protein in Drosophila. The fly protein is a component of the Notch signaling pathway, which functions in several developmental processes. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 G T 4: 53,049,125 T1651N probably damaging Het
Abca17 T TACCTG 17: 24,287,732 probably null Het
Ank1 T A 8: 23,119,344 F1380I probably benign Het
Apcs A T 1: 172,894,242 M179K probably damaging Het
Asb7 C T 7: 66,647,883 R287Q probably damaging Het
Begain G GCCGCCT 12: 109,033,437 probably null Het
Cacna2d1 A G 5: 16,025,776 T69A possibly damaging Het
Ccdc170 CCA CCAACA 10: 4,561,024 probably benign Het
Ccdc69 A G 11: 55,060,523 L24P probably damaging Het
Cdh16 T G 8: 104,617,052 N604T probably damaging Het
Crybg1 A G 10: 44,004,745 V149A probably benign Het
Cyb5r4 ACACTGCCCAGGGA ACACTGCCCAGGGATGTGACAGACGCACTGCCCAGGGA 9: 87,040,435 probably benign Het
Dnmt1 CAGTTCCTACCTCGTT CAGTTCCTACCTCGTTTTGGGGGCGGAGCAAAGTTCCTACCTCGTT 9: 20,910,130 probably null Het
Dnmt1 ACCTCGTT ACCTCGTTTTGGGGGCGGAGCACAGTTCCTCCCTCGTT 9: 20,910,138 probably benign Het
Efhd2 CCGCCG CCGCCGACGCCG 4: 141,874,762 probably benign Het
Enah GTGGCGGC G 1: 181,921,934 probably null Het
Entpd2 CTT CTTT 2: 25,400,895 probably null Het
Epha2 CCCCC CCCCCC 4: 141,323,406 unknown Het
Fam114a2 T C 11: 57,493,033 T359A probably benign Het
Farp1 A G 14: 121,237,148 I258V probably damaging Het
Fbxw28 G T 9: 109,338,526 Y54* probably null Het
Gabre CAGGCTCA C X: 72,270,177 probably null Het
Gm17660 A C 5: 104,074,859 probably null Het
Gprc5d A T 6: 135,116,519 L130Q probably damaging Het
H13 G A 2: 152,669,669 E30K probably damaging Het
Herc2 C T 7: 56,226,525 R4429C probably damaging Het
Kif21b A T 1: 136,158,341 T817S probably damaging Het
Kl A C 5: 150,953,420 Y235S probably benign Het
Klk5 T A 7: 43,842,374 V20D possibly damaging Het
Krtap28-10 TCCCACA TCCCACACCCACA 1: 83,042,123 probably benign Het
Krtap28-10 CAC CACGACAGCCACAGCAAC 1: 83,042,252 probably benign Het
Lamc2 T A 1: 153,152,055 T208S possibly damaging Het
Map1a GCTCCAGCTCCA GCTCCAGCTCCAGCTCCAGCTCCAGCTCCATCTCCAGCTCCA 2: 121,306,307 probably benign Het
Map3k5 A T 10: 20,100,172 N804I probably damaging Het
Map6d1 G A 16: 20,241,000 T105I probably benign Het
Mbd1 TGTCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC TATCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC 18: 74,273,573 probably benign Het
Mbd1 GTCTTCGTCTGCATCTGCATCTGCATCT GTCT 18: 74,273,610 probably benign Het
Mkl1 TTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTG 15: 81,018,255 probably benign Het
Mrgprx1 A AGAC 7: 48,021,511 probably benign Het
Mroh2a C A 1: 88,242,485 L710M probably damaging Het
Msmb A G 14: 32,158,090 D79G probably damaging Het
Nab2 A T 10: 127,664,364 D286E probably benign Het
Nrxn1 G A 17: 90,362,876 R1144C probably damaging Het
Otog A T 7: 46,287,669 T1601S probably damaging Het
Pan2 G A 10: 128,315,535 E842K probably benign Het
Pcca C T 14: 122,684,898 T357I probably damaging Het
Prop1 A C 11: 50,951,130 Y150D possibly damaging Het
Prss56 T C 1: 87,187,170 L465P probably benign Het
Psip1 T C 4: 83,460,498 I353M probably damaging Het
Rapgef3 A C 15: 97,760,740 H170Q probably benign Het
Rasal2 A T 1: 157,147,790 S1150T probably damaging Het
Rtbdn C CAGCGGA 8: 84,956,179 probably benign Het
Sap30bp T A 11: 115,960,507 I135N probably damaging Het
Sbp ATG ATGCTGACAACAAAGCTG 17: 23,945,387 probably benign Het
Slc35e4 A T 11: 3,907,960 L215Q possibly damaging Het
Smarca2 CAGC CAGCCCAAGC 19: 26,631,020 probably benign Het
Surf4 A T 2: 26,922,167 I183N probably benign Het
Tcof1 CAG CAGAAG 18: 60,835,738 probably benign Het
Timm23 T A 14: 32,180,555 *210C probably null Het
Tnfaip8 ACACACACACACACACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC AC 18: 50,046,831 probably benign Het
Trim66 A T 7: 109,460,740 L813Q possibly damaging Het
Trip10 G A 17: 57,255,045 A224T probably benign Het
Ttn T C 2: 76,907,599 T4245A unknown Het
Ttn T A 2: 76,908,025 I4103F unknown Het
Ubn2 T A 6: 38,463,628 M313K probably damaging Het
Ubr5 T C 15: 38,028,652 N521S Het
Utp20 A T 10: 88,825,457 D29E probably damaging Het
Vmn2r60 T A 7: 42,140,939 V450E probably benign Het
Wdr66 GAGGAGGAAGAGGAGGAAGAGGAGGGGGAGAAGGAG GAGGAGGAAGAGGAGGAAGAGGAGGGGGAGAAGGAGGAAAAGGAGGAAGAGGAGGAAGAGGAGGGGGAGAAGGAG 5: 123,253,883 probably benign Het
Wdr66 GGAAGAGGAGGAAGAGGAGGGGGAGAAGGAG GGAAGAGGAGGAAGAGGAGGGGGAGAAGGAGGAAAAGGAGGAAGAGGAGGAAGAGGAGGGGGAGAAGGAG 5: 123,253,888 probably benign Het
Wdr66 GAAGAGGAGGAAGAGGAGGGGGAGAAGGAG GAAGAGGAGGAAGAGGAGGGGGAGAAGGAGGAAAAGGAGAAAGAGGAGGAAGAGGAGGGGGAGAAGGAG 5: 123,253,889 probably benign Het
Wnt6 A T 1: 74,782,821 D187V probably damaging Het
Zc3h14 T C 12: 98,758,861 C261R probably damaging Het
Zfp384 GCCCAGGC GCCCAGGCCCAGCCCCAGGC 6: 125,036,489 probably benign Het
Zfp395 C T 14: 65,385,425 S3F unknown Het
Zfp583 T A 7: 6,316,982 I344F probably damaging Het
Zfp599 A C 9: 22,253,884 V65G probably benign Het
Zfp808 T C 13: 62,171,299 V114A probably benign Het
Zfp933 G A 4: 147,826,441 H233Y probably damaging Het
Znrd1as CACCACCACCACCAC CACCACCACCACCACCACCACTACCACCACCACCAC 17: 36,965,057 probably benign Het
Other mutations in Pcnx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Pcnx APN 12 81895101 missense probably damaging 0.98
IGL00561:Pcnx APN 12 81996053 missense probably damaging 1.00
IGL01066:Pcnx APN 12 81992021 missense possibly damaging 0.87
IGL01069:Pcnx APN 12 81918144 missense probably benign 0.27
IGL01082:Pcnx APN 12 81990598 missense possibly damaging 0.62
IGL01087:Pcnx APN 12 81995339 splice site probably benign
IGL01145:Pcnx APN 12 81992035 missense probably damaging 0.99
IGL01412:Pcnx APN 12 81906465 missense probably damaging 1.00
IGL01477:Pcnx APN 12 81973241 missense probably damaging 0.98
IGL01639:Pcnx APN 12 81950320 critical splice donor site probably null
IGL01815:Pcnx APN 12 81990551 missense probably damaging 1.00
IGL01870:Pcnx APN 12 81975893 missense probably benign 0.01
IGL01902:Pcnx APN 12 81979094 missense probably damaging 1.00
IGL01935:Pcnx APN 12 81917816 missense probably benign 0.00
IGL02141:Pcnx APN 12 81860382 missense possibly damaging 0.86
IGL02179:Pcnx APN 12 81933719 intron probably benign
IGL02197:Pcnx APN 12 81919104 missense probably benign 0.01
IGL02197:Pcnx APN 12 81993151 missense possibly damaging 0.85
IGL02238:Pcnx APN 12 81917914 missense probably damaging 1.00
IGL02430:Pcnx APN 12 81919322 missense possibly damaging 0.89
IGL02590:Pcnx APN 12 81994978 missense probably damaging 1.00
IGL02992:Pcnx APN 12 81964120 missense probably damaging 1.00
IGL03304:Pcnx APN 12 81982029 missense probably damaging 1.00
ihop UTSW 12 81971376 missense probably benign 0.09
PIT4515001:Pcnx UTSW 12 81991787 missense
R0086:Pcnx UTSW 12 81992058 unclassified probably benign
R0114:Pcnx UTSW 12 81996095 missense possibly damaging 0.95
R0240:Pcnx UTSW 12 81947018 missense possibly damaging 0.67
R0240:Pcnx UTSW 12 81947018 missense possibly damaging 0.67
R0376:Pcnx UTSW 12 81974579 splice site probably benign
R0377:Pcnx UTSW 12 81974579 splice site probably benign
R0416:Pcnx UTSW 12 81974466 missense probably benign 0.09
R0514:Pcnx UTSW 12 81995110 missense probably benign 0.21
R0563:Pcnx UTSW 12 81917944 missense probably damaging 1.00
R0569:Pcnx UTSW 12 81992030 missense probably benign 0.08
R0626:Pcnx UTSW 12 81983676 missense possibly damaging 0.82
R0972:Pcnx UTSW 12 81913412 missense probably damaging 1.00
R1205:Pcnx UTSW 12 81956243 missense probably damaging 1.00
R1455:Pcnx UTSW 12 81973234 missense probably damaging 1.00
R1514:Pcnx UTSW 12 81918798 missense probably damaging 1.00
R1731:Pcnx UTSW 12 81990704 missense probably damaging 1.00
R1758:Pcnx UTSW 12 81983484 missense probably benign 0.27
R1774:Pcnx UTSW 12 81975320 missense probably damaging 1.00
R1817:Pcnx UTSW 12 81918642 missense probably benign
R1843:Pcnx UTSW 12 81980935 missense probably damaging 1.00
R1862:Pcnx UTSW 12 81918732 missense probably damaging 1.00
R2042:Pcnx UTSW 12 81918293 missense probably damaging 1.00
R2054:Pcnx UTSW 12 81933674 missense probably benign 0.02
R2243:Pcnx UTSW 12 81918705 missense probably damaging 1.00
R2272:Pcnx UTSW 12 81995314 missense probably benign 0.26
R2360:Pcnx UTSW 12 81950186 missense probably damaging 0.99
R2926:Pcnx UTSW 12 81994995 missense probably damaging 1.00
R3607:Pcnx UTSW 12 81928292 missense probably damaging 1.00
R3781:Pcnx UTSW 12 81996118 missense probably benign 0.00
R3782:Pcnx UTSW 12 81996118 missense probably benign 0.00
R3806:Pcnx UTSW 12 81950137 missense possibly damaging 0.84
R3926:Pcnx UTSW 12 81958731 missense probably damaging 1.00
R4019:Pcnx UTSW 12 81918244 missense probably damaging 1.00
R4020:Pcnx UTSW 12 81918244 missense probably damaging 1.00
R4683:Pcnx UTSW 12 81986672 missense probably benign 0.01
R4703:Pcnx UTSW 12 81895164 missense probably benign 0.01
R4732:Pcnx UTSW 12 81995751 missense probably benign 0.01
R4733:Pcnx UTSW 12 81995751 missense probably benign 0.01
R4755:Pcnx UTSW 12 81950294 missense probably damaging 1.00
R4792:Pcnx UTSW 12 81919151 missense probably damaging 1.00
R4897:Pcnx UTSW 12 81918165 missense probably damaging 1.00
R4915:Pcnx UTSW 12 81974495 missense probably benign 0.10
R4934:Pcnx UTSW 12 81991825 missense possibly damaging 0.76
R4940:Pcnx UTSW 12 81917793 missense possibly damaging 0.60
R5079:Pcnx UTSW 12 81979089 nonsense probably null
R5087:Pcnx UTSW 12 81994939 missense probably damaging 1.00
R5284:Pcnx UTSW 12 81919029 missense probably benign 0.02
R5287:Pcnx UTSW 12 81982051 missense probably damaging 1.00
R5436:Pcnx UTSW 12 81860406 missense probably damaging 1.00
R5505:Pcnx UTSW 12 81950153 missense probably damaging 1.00
R5538:Pcnx UTSW 12 81860409 missense probably damaging 1.00
R5632:Pcnx UTSW 12 81917730 missense probably damaging 1.00
R5642:Pcnx UTSW 12 81895029 missense possibly damaging 0.45
R5841:Pcnx UTSW 12 81918655 missense possibly damaging 0.62
R6275:Pcnx UTSW 12 81918607 missense probably benign 0.34
R6508:Pcnx UTSW 12 81912705 missense probably damaging 0.98
R6532:Pcnx UTSW 12 81980964 missense probably damaging 1.00
R6634:Pcnx UTSW 12 81917882 nonsense probably null
R6753:Pcnx UTSW 12 81964480 missense probably damaging 1.00
R6776:Pcnx UTSW 12 81962722 missense possibly damaging 0.81
R6778:Pcnx UTSW 12 81918871 missense probably damaging 1.00
R6890:Pcnx UTSW 12 81971376 missense probably benign 0.09
R6894:Pcnx UTSW 12 81987973 missense probably damaging 1.00
R6927:Pcnx UTSW 12 81917812 missense probably benign 0.37
R7173:Pcnx UTSW 12 81953003 intron probably null
R7196:Pcnx UTSW 12 81995538 missense possibly damaging 0.94
R7316:Pcnx UTSW 12 81995549 missense probably benign 0.16
R7559:Pcnx UTSW 12 81993122 missense unknown
R7635:Pcnx UTSW 12 81919125 missense
R7669:Pcnx UTSW 12 81990551 missense probably damaging 1.00
R8021:Pcnx UTSW 12 81918819 nonsense probably null
R8049:Pcnx UTSW 12 81918819 nonsense probably null
Z1177:Pcnx UTSW 12 81918202 missense probably damaging 0.98
Z1177:Pcnx UTSW 12 81918677 missense
Predicted Primers PCR Primer
(F):5'- ACTGGTTAGCTCTGCTTGAG -3'
(R):5'- CTCAGTGATGCGTCAGGAAAAG -3'

Sequencing Primer
(F):5'- GAGGTTTGCTCATACTTGACTTAC -3'
(R):5'- TGGAAGTCCGTGGCACTC -3'
Posted On2019-12-04