Incidental Mutation 'RF024:Abca17'
ID 604095
Institutional Source Beutler Lab
Gene Symbol Abca17
Ensembl Gene ENSMUSG00000035435
Gene Name ATP-binding cassette, sub-family A (ABC1), member 17
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # RF024 (G1)
Quality Score 143.467
Status Not validated
Chromosome 17
Chromosomal Location 24264259-24351029 bp(-) (GRCm38)
Type of Mutation frame shift
DNA Base Change (assembly) T to TACCTG at 24287732 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000046218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039324] [ENSMUST00000121226]
AlphaFold E9PX95
Predicted Effect probably null
Transcript: ENSMUST00000039324
SMART Domains Protein: ENSMUSP00000046218
Gene: ENSMUSG00000035435

low complexity region 4 18 N/A INTRINSIC
transmembrane domain 22 44 N/A INTRINSIC
Pfam:ABC2_membrane_3 252 464 9.5e-17 PFAM
AAA 547 729 5.71e-12 SMART
low complexity region 846 857 N/A INTRINSIC
Pfam:ABC2_membrane_3 905 1307 6.7e-35 PFAM
low complexity region 1337 1351 N/A INTRINSIC
AAA 1393 1577 1.15e-1 SMART
low complexity region 1697 1730 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000121226
SMART Domains Protein: ENSMUSP00000112538
Gene: ENSMUSG00000035435

low complexity region 4 18 N/A INTRINSIC
Pfam:ABC2_membrane_3 21 464 1.2e-15 PFAM
AAA 547 729 5.71e-12 SMART
low complexity region 846 857 N/A INTRINSIC
Pfam:ABC2_membrane_3 905 1307 1.1e-32 PFAM
low complexity region 1337 1351 N/A INTRINSIC
AAA 1393 1577 1.15e-1 SMART
low complexity region 1697 1730 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.3%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 G T 4: 53,049,125 T1651N probably damaging Het
Adgra3 A T 5: 50,013,387 probably null Het
Ank1 T A 8: 23,119,344 F1380I probably benign Het
Apcs A T 1: 172,894,242 M179K probably damaging Het
Asb7 C T 7: 66,647,883 R287Q probably damaging Het
Begain G GCCGCCT 12: 109,033,437 probably null Het
Cacna2d1 A G 5: 16,025,776 T69A possibly damaging Het
Ccdc170 CCA CCAACA 10: 4,561,024 probably benign Het
Ccdc69 A G 11: 55,060,523 L24P probably damaging Het
Cdh16 T G 8: 104,617,052 N604T probably damaging Het
Crybg1 A G 10: 44,004,745 V149A probably benign Het
Efhd2 CCGCCG CCGCCGACGCCG 4: 141,874,762 probably benign Het
Enah GTGGCGGC G 1: 181,921,934 probably null Het
Entpd2 CTT CTTT 2: 25,400,895 probably null Het
Epha2 CCCCC CCCCCC 4: 141,323,406 unknown Het
Fam114a2 T C 11: 57,493,033 T359A probably benign Het
Farp1 A G 14: 121,237,148 I258V probably damaging Het
Fbxw28 G T 9: 109,338,526 Y54* probably null Het
Gabre CAGGCTCA C X: 72,270,177 probably null Het
Gm17660 A C 5: 104,074,859 probably null Het
Gprc5d A T 6: 135,116,519 L130Q probably damaging Het
H13 G A 2: 152,669,669 E30K probably damaging Het
Herc2 C T 7: 56,226,525 R4429C probably damaging Het
Kif21b A T 1: 136,158,341 T817S probably damaging Het
Kl A C 5: 150,953,420 Y235S probably benign Het
Klk5 T A 7: 43,842,374 V20D possibly damaging Het
Krtap28-10 TCCCACA TCCCACACCCACA 1: 83,042,123 probably benign Het
Krtap28-10 CAC CACGACAGCCACAGCAAC 1: 83,042,252 probably benign Het
Lamc2 T A 1: 153,152,055 T208S possibly damaging Het
Map3k5 A T 10: 20,100,172 N804I probably damaging Het
Map6d1 G A 16: 20,241,000 T105I probably benign Het
Mbd1 GTCTTCGTCTGCATCTGCATCTGCATCT GTCT 18: 74,273,610 probably benign Het
Mrgprx1 A AGAC 7: 48,021,511 probably benign Het
Mroh2a C A 1: 88,242,485 L710M probably damaging Het
Msmb A G 14: 32,158,090 D79G probably damaging Het
Nab2 A T 10: 127,664,364 D286E probably benign Het
Nrxn1 G A 17: 90,362,876 R1144C probably damaging Het
Otog A T 7: 46,287,669 T1601S probably damaging Het
Pan2 G A 10: 128,315,535 E842K probably benign Het
Pcca C T 14: 122,684,898 T357I probably damaging Het
Pcnx C T 12: 81,917,727 P223S probably damaging Het
Prop1 A C 11: 50,951,130 Y150D possibly damaging Het
Prss56 T C 1: 87,187,170 L465P probably benign Het
Psip1 T C 4: 83,460,498 I353M probably damaging Het
Rapgef3 A C 15: 97,760,740 H170Q probably benign Het
Rasal2 A T 1: 157,147,790 S1150T probably damaging Het
Rtbdn C CAGCGGA 8: 84,956,179 probably benign Het
Sap30bp T A 11: 115,960,507 I135N probably damaging Het
Sbp ATG ATGCTGACAACAAAGCTG 17: 23,945,387 probably benign Het
Slc35e4 A T 11: 3,907,960 L215Q possibly damaging Het
Slc6a20b A T 9: 123,598,342 probably benign Het
Smarca2 CAGC CAGCCCAAGC 19: 26,631,020 probably benign Het
Surf4 A T 2: 26,922,167 I183N probably benign Het
Tcof1 CAG CAGAAG 18: 60,835,738 probably benign Het
Timm23 T A 14: 32,180,555 *210C probably null Het
Trim66 A T 7: 109,460,740 L813Q possibly damaging Het
Trip10 G A 17: 57,255,045 A224T probably benign Het
Ttn T C 2: 76,907,599 T4245A unknown Het
Ttn T A 2: 76,908,025 I4103F unknown Het
Ubn2 T A 6: 38,463,628 M313K probably damaging Het
Ubr5 T C 15: 38,028,652 N521S Het
Utp20 A T 10: 88,825,457 D29E probably damaging Het
Vmn2r60 T A 7: 42,140,939 V450E probably benign Het
Wnt6 A T 1: 74,782,821 D187V probably damaging Het
Zc3h14 T C 12: 98,758,861 C261R probably damaging Het
Zfp384 GCCCAGGC GCCCAGGCCCAGCCCCAGGC 6: 125,036,489 probably benign Het
Zfp395 C T 14: 65,385,425 S3F unknown Het
Zfp583 T A 7: 6,316,982 I344F probably damaging Het
Zfp599 A C 9: 22,253,884 V65G probably benign Het
Zfp808 T C 13: 62,171,299 V114A probably benign Het
Zfp933 G A 4: 147,826,441 H233Y probably damaging Het
Other mutations in Abca17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Abca17 APN 17 24295191 missense probably benign 0.14
IGL00585:Abca17 APN 17 24300320 missense probably damaging 0.99
IGL00941:Abca17 APN 17 24317130 missense probably damaging 1.00
IGL01987:Abca17 APN 17 24346228 missense probably benign 0.00
IGL01988:Abca17 APN 17 24334255 missense probably damaging 0.99
IGL02223:Abca17 APN 17 24287935 nonsense probably null
IGL02368:Abca17 APN 17 24287793 missense probably benign 0.01
IGL02405:Abca17 APN 17 24279062 missense possibly damaging 0.80
IGL02431:Abca17 APN 17 24298984 missense probably benign 0.05
IGL02607:Abca17 APN 17 24327705 nonsense probably null
IGL02706:Abca17 APN 17 24298992 missense probably benign 0.00
IGL02729:Abca17 APN 17 24280481 missense probably benign 0.06
IGL02818:Abca17 APN 17 24300352 missense probably benign 0.02
IGL02891:Abca17 APN 17 24281366 missense probably damaging 0.99
IGL03236:Abca17 APN 17 24326476 splice site probably benign
IGL03299:Abca17 APN 17 24265591 missense probably damaging 1.00
basin UTSW 17 24318185 missense probably benign 0.01
Bowl UTSW 17 24317238 missense probably benign 0.09
R0018:Abca17 UTSW 17 24313188 splice site probably null
R0467:Abca17 UTSW 17 24313177 splice site probably benign
R0671:Abca17 UTSW 17 24281249 missense probably benign 0.00
R1175:Abca17 UTSW 17 24289351 missense possibly damaging 0.91
R1397:Abca17 UTSW 17 24285759 missense probably benign 0.18
R1398:Abca17 UTSW 17 24328537 missense probably damaging 0.96
R1678:Abca17 UTSW 17 24335620 missense probably benign 0.05
R1696:Abca17 UTSW 17 24267658 missense possibly damaging 0.90
R1781:Abca17 UTSW 17 24267557 missense possibly damaging 0.95
R1845:Abca17 UTSW 17 24267716 missense probably damaging 1.00
R1970:Abca17 UTSW 17 24307575 missense probably benign 0.00
R1997:Abca17 UTSW 17 24285726 missense probably benign 0.02
R2141:Abca17 UTSW 17 24334266 missense probably benign 0.00
R2199:Abca17 UTSW 17 24335624 missense probably benign 0.19
R2394:Abca17 UTSW 17 24281216 splice site probably null
R2442:Abca17 UTSW 17 24328632 missense probably benign 0.02
R2509:Abca17 UTSW 17 24289613 splice site probably benign
R2848:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R2849:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R2859:Abca17 UTSW 17 24281314 missense possibly damaging 0.46
R2879:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R2935:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R3153:Abca17 UTSW 17 24328746 missense probably damaging 1.00
R3154:Abca17 UTSW 17 24328746 missense probably damaging 1.00
R3434:Abca17 UTSW 17 24289537 missense probably damaging 1.00
R3695:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R3905:Abca17 UTSW 17 24296283 missense probably benign 0.13
R4282:Abca17 UTSW 17 24299060 missense possibly damaging 0.49
R4334:Abca17 UTSW 17 24318268 missense probably damaging 1.00
R4350:Abca17 UTSW 17 24279046 critical splice donor site probably null
R4548:Abca17 UTSW 17 24334271 missense possibly damaging 0.82
R4626:Abca17 UTSW 17 24321084 missense probably damaging 1.00
R4722:Abca17 UTSW 17 24265429 missense probably damaging 1.00
R4745:Abca17 UTSW 17 24307453 missense probably damaging 1.00
R4818:Abca17 UTSW 17 24317161 missense probably damaging 0.98
R5279:Abca17 UTSW 17 24289414 missense probably damaging 1.00
R5310:Abca17 UTSW 17 24281230 missense probably benign 0.00
R5320:Abca17 UTSW 17 24307567 missense probably damaging 1.00
R5435:Abca17 UTSW 17 24267614 missense possibly damaging 0.90
R5622:Abca17 UTSW 17 24327668 missense probably benign 0.14
R5776:Abca17 UTSW 17 24295158 missense probably benign 0.09
R5928:Abca17 UTSW 17 24318185 missense probably benign 0.01
R6013:Abca17 UTSW 17 24287846 missense possibly damaging 0.79
R6035:Abca17 UTSW 17 24281245 missense possibly damaging 0.79
R6035:Abca17 UTSW 17 24281245 missense possibly damaging 0.79
R6052:Abca17 UTSW 17 24318191 missense probably benign 0.00
R6063:Abca17 UTSW 17 24264344 missense unknown
R6404:Abca17 UTSW 17 24265918 missense probably benign 0.13
R6746:Abca17 UTSW 17 24346221 nonsense probably null
R6819:Abca17 UTSW 17 24287793 missense probably benign 0.01
R6828:Abca17 UTSW 17 24326415 missense possibly damaging 0.91
R7043:Abca17 UTSW 17 24265500 missense probably damaging 1.00
R7065:Abca17 UTSW 17 24327751 missense probably damaging 1.00
R7123:Abca17 UTSW 17 24265975 missense probably damaging 1.00
R7157:Abca17 UTSW 17 24335590 missense possibly damaging 0.46
R7188:Abca17 UTSW 17 24335626 missense possibly damaging 0.89
R7294:Abca17 UTSW 17 24321009 missense not run
R7352:Abca17 UTSW 17 24289054 nonsense probably null
R7355:Abca17 UTSW 17 24267647 missense probably benign 0.00
R7358:Abca17 UTSW 17 24291555 missense probably benign 0.00
R7411:Abca17 UTSW 17 24328569 missense possibly damaging 0.52
R7915:Abca17 UTSW 17 24265533 missense probably damaging 1.00
R8039:Abca17 UTSW 17 24328725 missense probably damaging 1.00
R8095:Abca17 UTSW 17 24317222 missense possibly damaging 0.77
R8308:Abca17 UTSW 17 24267683 missense probably damaging 1.00
R8517:Abca17 UTSW 17 24317233 missense probably benign 0.00
R8811:Abca17 UTSW 17 24317238 missense probably benign 0.09
R8819:Abca17 UTSW 17 24328602 missense probably damaging 1.00
R8820:Abca17 UTSW 17 24328602 missense probably damaging 1.00
R8953:Abca17 UTSW 17 24299041 missense probably benign
R9095:Abca17 UTSW 17 24281396 missense probably damaging 0.97
R9313:Abca17 UTSW 17 24346233 missense probably benign 0.00
R9314:Abca17 UTSW 17 24328619 missense possibly damaging 0.91
R9347:Abca17 UTSW 17 24264505 missense probably benign
R9351:Abca17 UTSW 17 24291777 missense probably benign 0.00
R9387:Abca17 UTSW 17 24334281 missense probably benign 0.02
R9388:Abca17 UTSW 17 24264299 missense unknown
RF029:Abca17 UTSW 17 24287727 critical splice donor site probably benign
RF032:Abca17 UTSW 17 24287727 frame shift probably null
RF036:Abca17 UTSW 17 24287727 critical splice donor site probably benign
X0017:Abca17 UTSW 17 24317163 missense probably benign 0.26
X0065:Abca17 UTSW 17 24334284 missense probably damaging 1.00
Z1088:Abca17 UTSW 17 24279079 missense probably damaging 0.96
Z1088:Abca17 UTSW 17 24279107 missense probably benign 0.03
Z1088:Abca17 UTSW 17 24346219 missense probably damaging 0.98
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2019-12-04