Incidental Mutation 'RF025:Lcmt1'
ID604121
Institutional Source Beutler Lab
Gene Symbol Lcmt1
Ensembl Gene ENSMUSG00000030763
Gene Nameleucine carboxyl methyltransferase 1
SynonymsLCMT-1, Lcmt
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF025 (G1)
Quality Score140.593
Status Not validated
Chromosome7
Chromosomal Location123369784-123430358 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GGC to GGCCGCGGGGCGC at 123369834 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098060] [ENSMUST00000106442] [ENSMUST00000167309] [ENSMUST00000205262] [ENSMUST00000205936] [ENSMUST00000206117] [ENSMUST00000206721] [ENSMUST00000207010]
Predicted Effect probably benign
Transcript: ENSMUST00000098060
SMART Domains Protein: ENSMUSP00000095668
Gene: ENSMUSG00000030766

DomainStartEndE-ValueType
BAR 1 239 4.45e-65 SMART
RhoGAP 263 439 1.2e-60 SMART
low complexity region 554 595 N/A INTRINSIC
low complexity region 624 640 N/A INTRINSIC
low complexity region 644 664 N/A INTRINSIC
low complexity region 683 704 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106442
SMART Domains Protein: ENSMUSP00000102050
Gene: ENSMUSG00000030766

DomainStartEndE-ValueType
BAR 1 239 4.45e-65 SMART
RhoGAP 263 439 1.2e-60 SMART
low complexity region 542 557 N/A INTRINSIC
low complexity region 570 582 N/A INTRINSIC
low complexity region 632 673 N/A INTRINSIC
low complexity region 702 718 N/A INTRINSIC
low complexity region 722 742 N/A INTRINSIC
low complexity region 761 782 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167309
SMART Domains Protein: ENSMUSP00000128447
Gene: ENSMUSG00000030766

DomainStartEndE-ValueType
BAR 1 239 4.45e-65 SMART
RhoGAP 263 439 1.2e-60 SMART
low complexity region 542 557 N/A INTRINSIC
low complexity region 570 582 N/A INTRINSIC
low complexity region 632 673 N/A INTRINSIC
low complexity region 702 718 N/A INTRINSIC
low complexity region 722 742 N/A INTRINSIC
low complexity region 761 782 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205262
Predicted Effect probably benign
Transcript: ENSMUST00000205936
Predicted Effect probably benign
Transcript: ENSMUST00000206117
Predicted Effect probably null
Transcript: ENSMUST00000206721
Predicted Effect probably benign
Transcript: ENSMUST00000207010
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] LCMT1 catalyzes the methylation of the carboxyl group of the C-terminal leucine residue (leu309) of the catalytic subunit of protein phosphatase-2A (PPP2CA; MIM 176915) (De Baere et al., 1999 [PubMed 10600115]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap allele are embryonic lethal. Mice homozygous for a hypomorphic gene trap allele exhibit partial embryonic lethality, insulin resistance and impaired glucose tolerance. Mice homozygous for a transgenic gene disruption exhibit kidney agenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 CTGCTG CTGCTGCATCCTGGGTTGCTG 4: 155,905,102 probably benign Het
AI837181 GGC GGCCGC 19: 5,425,226 probably benign Het
Arid1b GCG GCGTCG 17: 4,995,588 probably benign Het
Arid1b GGC GGCTGC 17: 4,995,596 probably benign Het
AY358078 CAGGT CAGGTAGGATAAGGT 14: 51,805,589 probably null Het
AY761185 GCACTGTGGGC G 8: 20,943,902 probably null Het
Bcar1 C A 8: 111,714,177 R395L possibly damaging Het
Begain CGCCGC CGCCGCGGCCGC 12: 109,033,424 probably benign Het
Cacna1f GAG GAGTAG X: 7,620,057 probably null Het
Calhm1 GC GCTGTGGCTGTGTC 19: 47,141,276 probably benign Het
Calhm1 C CTGTGAATGTGGA 19: 47,141,277 probably benign Het
Ccdc170 ACC ACCCCC 10: 4,561,026 probably benign Het
Cyb5r4 AGGGA AGGGATGTGACAGTCACACTGCCCTGGGA 9: 87,040,444 probably benign Het
Defb22 GCTGGCCT GCTGGCCTCTGCGGCAGACCTGGCCT 2: 152,485,823 probably benign Het
Defb22 CTGGC CTGGCGTTTGCGGCAGAGATGGC 2: 152,485,824 probably benign Het
Dnmt1 GGGCGGAGCACAGTTCCTACCTCGTT GGGCGGAGCACAGTTCCTACCTCGTTTTGGCGGCGGAGCACAGTTCCTACCTCGTT 9: 20,910,120 probably null Het
Dnmt1 CCTACCTCGTT CCTACCTCGTTTTGGGGGCGGAGAACAGTTTCTACCTCGTT 9: 20,910,135 probably null Het
Dock4 GTGCCGGTGCCGGT G 12: 40,844,393 probably null Het
Efhd2 CCGCC CCGCCGACGCC 4: 141,874,771 probably benign Het
Epha8 CCTGGGC CC 4: 136,933,037 probably benign Het
Eps8 CTCA CTCAATCA 6: 137,517,066 probably benign Het
Exd2 CAGCCAGAGC CAGC 12: 80,475,955 probably benign Het
Gab3 TCT TCTGCT X: 75,000,008 probably benign Het
Gm5475 GAAGGAAAGGT G 15: 100,427,152 probably null Het
Gm8369 TGTG TGTGCGTG 19: 11,511,773 probably null Het
Gm9573 CGGGGTAGGTGTAGATCCTGAGGCAGTGCTGGATGCAGGGGTGGTTGGGGTGGGTGTAGATCCTGAGGCAGTGCTGGATGCAG CGGGGTGGGTGTAGATCCTGAGGCAGTGCTGGATGCAG 17: 35,622,879 probably benign Het
Gpatch3 GGAG GG 4: 133,578,310 probably null Het
Heatr3 TTAT TTATGTAT 8: 88,156,456 probably benign Het
Hsdl2 GCAGGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGC GCAGGAGCAGCCACAGCTGCAGGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGC 4: 59,610,637 probably benign Het
Igf1r GATGGAGC GATGGAGCTGGATATGGAGC 7: 68,226,179 probably benign Het
Krtap28-10 AGCCACAGCCACCACAGCCACAGCCACCAC AGCCACAGCCACCACCGCCACAGCCACCACAGCCACAGCCACCAC 1: 83,042,258 probably benign Het
Las1l CTTCCT CTTCCTATTCCT X: 95,940,620 probably null Het
Mamld1 AGC AGCCGC X: 71,118,826 probably benign Het
Map1a AGC AGCGCCAGCTCCAGCTCCAGCTCCAGCTCCCGC 2: 121,306,294 probably benign Het
Mdc1 CCCCCCCC CCCCCCCCCCCCCC 17: 35,854,407 probably benign Het
Mn1 CAG CAGTAG 5: 111,419,705 probably null Het
Morn4 GCAG GCAGGGAGTCAGTCAG 19: 42,076,111 probably null Het
Nefh CCTCAGCTGGGGACTTGG CCTCAGCTGGGGACTTGGGCTCAGCTGGGGACTTGG 11: 4,941,003 probably benign Het
Nefh GGG GGGTACTTGTCCTCACCTTGG 11: 4,941,029 probably benign Het
Padi3 TCTCAC TC 4: 140,792,972 probably benign Het
Pdik1l CCC CCCCACC 4: 134,286,594 probably null Het
Plekhs1 TCCAGAC TCCAGACCTCCCCCCAGAC 19: 56,479,858 probably benign Het
Rtbdn GCGGC GCGGCAACGGC 8: 84,956,175 probably benign Het
Sh3pxd2b TGTGCCTGT TGTGCCTGTGCCTGT 11: 32,423,057 probably benign Het
Slamf6 GAGTATTATTCTTTTGTTTGTTTGTTTGTTTGTTTGTTTACAG GAG 1: 171,941,582 probably benign Het
Tfeb GCAACA GCAACAACA 17: 47,786,088 probably benign Het
Zfp106 CTCCTGGCAGT CT 2: 120,524,545 probably benign Het
Znrd1as CACCACCACCACCACCACCAC CACCACCACCACCACCACCACAACCACCACCACCACCACCAC 17: 36,965,048 probably benign Het
Other mutations in Lcmt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Lcmt1 APN 7 123428153 missense probably damaging 1.00
IGL01536:Lcmt1 APN 7 123422743 missense possibly damaging 0.46
IGL01564:Lcmt1 APN 7 123404440 missense probably benign 0.00
IGL02598:Lcmt1 APN 7 123421648 splice site probably benign
rancho UTSW 7 123401495 missense probably benign 0.03
relasso UTSW 7 123401468 missense probably damaging 1.00
R0665:Lcmt1 UTSW 7 123402871 missense probably damaging 1.00
R0668:Lcmt1 UTSW 7 123402871 missense probably damaging 1.00
R0943:Lcmt1 UTSW 7 123401439 splice site probably null
R1574:Lcmt1 UTSW 7 123402908 missense probably damaging 1.00
R1574:Lcmt1 UTSW 7 123402908 missense probably damaging 1.00
R2896:Lcmt1 UTSW 7 123421586 missense possibly damaging 0.95
R3017:Lcmt1 UTSW 7 123430136 missense probably damaging 1.00
R3547:Lcmt1 UTSW 7 123400479 missense probably benign 0.07
R3714:Lcmt1 UTSW 7 123404460 missense probably damaging 0.98
R4092:Lcmt1 UTSW 7 123418253 missense probably damaging 1.00
R4628:Lcmt1 UTSW 7 123410812 nonsense probably null
R5062:Lcmt1 UTSW 7 123410830 splice site probably null
R5096:Lcmt1 UTSW 7 123401468 missense probably damaging 1.00
R5549:Lcmt1 UTSW 7 123428107 missense probably damaging 1.00
R5573:Lcmt1 UTSW 7 123401463 missense probably benign 0.03
R5931:Lcmt1 UTSW 7 123421616 missense probably benign
R6331:Lcmt1 UTSW 7 123378182 intron probably benign
R7752:Lcmt1 UTSW 7 123369807 missense unknown
R7784:Lcmt1 UTSW 7 123401495 missense probably benign 0.03
RF013:Lcmt1 UTSW 7 123369836 frame shift probably null
RF046:Lcmt1 UTSW 7 123369834 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GTAAAGACCCTCGTGAGTCTCC -3'
(R):5'- TTAACTCCGCCCATGTTGG -3'

Sequencing Primer
(F):5'- TGAGTCTCCCGAGGACGATG -3'
(R):5'- ATGTTGGGTCCGTCCGCAC -3'
Posted On2019-12-04