Incidental Mutation 'RF025:Rtbdn'
ID604123
Institutional Source Beutler Lab
Gene Symbol Rtbdn
Ensembl Gene ENSMUSG00000048617
Gene Nameretbindin
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF025 (G1)
Quality Score214.461
Status Not validated
Chromosome8
Chromosomal Location84946991-84956603 bp(+) (GRCm38)
Type of Mutationsmall insertion (2 aa in frame mutation)
DNA Base Change (assembly) GCGGC to GCGGCAACGGC at 84956175 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065049] [ENSMUST00000067472] [ENSMUST00000109736] [ENSMUST00000109738] [ENSMUST00000109740] [ENSMUST00000121880] [ENSMUST00000128972] [ENSMUST00000147812] [ENSMUST00000152378]
Predicted Effect probably benign
Transcript: ENSMUST00000065049
SMART Domains Protein: ENSMUSP00000066769
Gene: ENSMUSG00000052926

DomainStartEndE-ValueType
Pfam:RNase_HII 31 242 7.1e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000067472
SMART Domains Protein: ENSMUSP00000070558
Gene: ENSMUSG00000048617

DomainStartEndE-ValueType
Pfam:Folate_rec 27 203 2e-40 PFAM
low complexity region 224 234 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109736
SMART Domains Protein: ENSMUSP00000105358
Gene: ENSMUSG00000052926

DomainStartEndE-ValueType
Pfam:RNase_HII 31 242 1.3e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109738
SMART Domains Protein: ENSMUSP00000105360
Gene: ENSMUSG00000052926

DomainStartEndE-ValueType
Pfam:RNase_HII 31 242 5.5e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109740
SMART Domains Protein: ENSMUSP00000105362
Gene: ENSMUSG00000048617

DomainStartEndE-ValueType
Pfam:Folate_rec 27 203 3.5e-42 PFAM
low complexity region 224 234 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121880
SMART Domains Protein: ENSMUSP00000113982
Gene: ENSMUSG00000048617

DomainStartEndE-ValueType
Pfam:Folate_rec 27 203 3.5e-42 PFAM
low complexity region 224 234 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128972
SMART Domains Protein: ENSMUSP00000121864
Gene: ENSMUSG00000052926

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:RNase_HII 57 268 1.4e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147812
SMART Domains Protein: ENSMUSP00000120374
Gene: ENSMUSG00000052926

DomainStartEndE-ValueType
Pfam:RNase_HII 31 242 1.3e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152378
SMART Domains Protein: ENSMUSP00000132841
Gene: ENSMUSG00000048617

DomainStartEndE-ValueType
Pfam:Folate_rec 2 172 2.8e-38 PFAM
low complexity region 193 203 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was first identified in a study of human eye tissues. The protein encoded by this gene is preferentially expressed in the retina and may play a role in binding retinoids and other carotenoids as it shares homology with riboflavin binding proteins. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 CTGCTG CTGCTGCATCCTGGGTTGCTG 4: 155,905,102 probably benign Het
AI837181 GGC GGCCGC 19: 5,425,226 probably benign Het
Arid1b GCG GCGTCG 17: 4,995,588 probably benign Het
Arid1b GGC GGCTGC 17: 4,995,596 probably benign Het
AY358078 CAGGT CAGGTAGGATAAGGT 14: 51,805,589 probably null Het
AY761185 GCACTGTGGGC G 8: 20,943,902 probably null Het
Bcar1 C A 8: 111,714,177 R395L possibly damaging Het
Begain CGCCGC CGCCGCGGCCGC 12: 109,033,424 probably benign Het
Cacna1f GAG GAGTAG X: 7,620,057 probably null Het
Calhm1 GC GCTGTGGCTGTGTC 19: 47,141,276 probably benign Het
Calhm1 C CTGTGAATGTGGA 19: 47,141,277 probably benign Het
Ccdc170 ACC ACCCCC 10: 4,561,026 probably benign Het
Cyb5r4 AGGGA AGGGATGTGACAGTCACACTGCCCTGGGA 9: 87,040,444 probably benign Het
Defb22 GCTGGCCT GCTGGCCTCTGCGGCAGACCTGGCCT 2: 152,485,823 probably benign Het
Defb22 CTGGC CTGGCGTTTGCGGCAGAGATGGC 2: 152,485,824 probably benign Het
Dnmt1 GGGCGGAGCACAGTTCCTACCTCGTT GGGCGGAGCACAGTTCCTACCTCGTTTTGGCGGCGGAGCACAGTTCCTACCTCGTT 9: 20,910,120 probably null Het
Dnmt1 CCTACCTCGTT CCTACCTCGTTTTGGGGGCGGAGAACAGTTTCTACCTCGTT 9: 20,910,135 probably null Het
Dock4 GTGCCGGTGCCGGT G 12: 40,844,393 probably null Het
Efhd2 CCGCC CCGCCGACGCC 4: 141,874,771 probably benign Het
Epha8 CCTGGGC CC 4: 136,933,037 probably benign Het
Eps8 CTCA CTCAATCA 6: 137,517,066 probably benign Het
Exd2 CAGCCAGAGC CAGC 12: 80,475,955 probably benign Het
Gab3 TCT TCTGCT X: 75,000,008 probably benign Het
Gm5475 GAAGGAAAGGT G 15: 100,427,152 probably null Het
Gm8369 TGTG TGTGCGTG 19: 11,511,773 probably null Het
Gm9573 CGGGGTAGGTGTAGATCCTGAGGCAGTGCTGGATGCAGGGGTGGTTGGGGTGGGTGTAGATCCTGAGGCAGTGCTGGATGCAG CGGGGTGGGTGTAGATCCTGAGGCAGTGCTGGATGCAG 17: 35,622,879 probably benign Het
Gpatch3 GGAG GG 4: 133,578,310 probably null Het
Heatr3 TTAT TTATGTAT 8: 88,156,456 probably benign Het
Hsdl2 GCAGGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGC GCAGGAGCAGCCACAGCTGCAGGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGC 4: 59,610,637 probably benign Het
Igf1r GATGGAGC GATGGAGCTGGATATGGAGC 7: 68,226,179 probably benign Het
Krtap28-10 AGCCACAGCCACCACAGCCACAGCCACCAC AGCCACAGCCACCACCGCCACAGCCACCACAGCCACAGCCACCAC 1: 83,042,258 probably benign Het
Las1l CTTCCT CTTCCTATTCCT X: 95,940,620 probably null Het
Lcmt1 GGC GGCCGCGGGGCGC 7: 123,369,834 probably null Het
Mamld1 AGC AGCCGC X: 71,118,826 probably benign Het
Map1a AGC AGCGCCAGCTCCAGCTCCAGCTCCAGCTCCCGC 2: 121,306,294 probably benign Het
Mdc1 CCCCCCCC CCCCCCCCCCCCCC 17: 35,854,407 probably benign Het
Mn1 CAG CAGTAG 5: 111,419,705 probably null Het
Morn4 GCAG GCAGGGAGTCAGTCAG 19: 42,076,111 probably null Het
Nefh CCTCAGCTGGGGACTTGG CCTCAGCTGGGGACTTGGGCTCAGCTGGGGACTTGG 11: 4,941,003 probably benign Het
Nefh GGG GGGTACTTGTCCTCACCTTGG 11: 4,941,029 probably benign Het
Padi3 TCTCAC TC 4: 140,792,972 probably benign Het
Pdik1l CCC CCCCACC 4: 134,286,594 probably null Het
Plekhs1 TCCAGAC TCCAGACCTCCCCCCAGAC 19: 56,479,858 probably benign Het
Sh3pxd2b TGTGCCTGT TGTGCCTGTGCCTGT 11: 32,423,057 probably benign Het
Slamf6 GAGTATTATTCTTTTGTTTGTTTGTTTGTTTGTTTGTTTACAG GAG 1: 171,941,582 probably benign Het
Tfeb GCAACA GCAACAACA 17: 47,786,088 probably benign Het
Zfp106 CTCCTGGCAGT CT 2: 120,524,545 probably benign Het
Znrd1as CACCACCACCACCACCACCAC CACCACCACCACCACCACCACAACCACCACCACCACCACCAC 17: 36,965,048 probably benign Het
Other mutations in Rtbdn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02892:Rtbdn APN 8 84955089 missense probably damaging 1.00
IGL03192:Rtbdn APN 8 84952655 missense probably benign 0.32
FR4342:Rtbdn UTSW 8 84956168 small insertion probably benign
FR4342:Rtbdn UTSW 8 84956178 small insertion probably benign
FR4589:Rtbdn UTSW 8 84956171 small insertion probably benign
FR4737:Rtbdn UTSW 8 84956161 small insertion probably benign
FR4737:Rtbdn UTSW 8 84956168 small insertion probably benign
FR4737:Rtbdn UTSW 8 84956176 small insertion probably benign
FR4737:Rtbdn UTSW 8 84956177 small insertion probably benign
R1581:Rtbdn UTSW 8 84955066 missense probably benign 0.01
R5057:Rtbdn UTSW 8 84955009 missense probably damaging 1.00
R6788:Rtbdn UTSW 8 84952674 missense probably null 1.00
R7570:Rtbdn UTSW 8 84952927 missense probably damaging 1.00
RF023:Rtbdn UTSW 8 84956166 small insertion probably benign
RF024:Rtbdn UTSW 8 84956179 small insertion probably benign
RF034:Rtbdn UTSW 8 84956175 small insertion probably benign
RF046:Rtbdn UTSW 8 84956179 small insertion probably benign
RF050:Rtbdn UTSW 8 84956170 small insertion probably benign
RF056:Rtbdn UTSW 8 84956170 small insertion probably benign
RF056:Rtbdn UTSW 8 84956172 small insertion probably benign
RF057:Rtbdn UTSW 8 84956166 small insertion probably benign
RF058:Rtbdn UTSW 8 84956172 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- GGCCATACCTAGTCCAGAAGAC -3'
(R):5'- GTGTTTTCCCAAGCAGCAGC -3'

Sequencing Primer
(F):5'- AGCCCAGAGACTCAGGTTC -3'
(R):5'- CAAGCAGCAGCCATGTCGTATG -3'
Posted On2019-12-04