Incidental Mutation 'RF025:Heatr3'
ID604124
Institutional Source Beutler Lab
Gene Symbol Heatr3
Ensembl Gene ENSMUSG00000031657
Gene NameHEAT repeat containing 3
SynonymsC030036P15Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.939) question?
Stock #RF025 (G1)
Quality Score217.468
Status Not validated
Chromosome8
Chromosomal Location88137855-88172027 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) TTAT to TTATGTAT at 88156456 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000034079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034079] [ENSMUST00000121949]
Predicted Effect probably benign
Transcript: ENSMUST00000034079
SMART Domains Protein: ENSMUSP00000034079
Gene: ENSMUSG00000031657

DomainStartEndE-ValueType
Pfam:HEAT_EZ 41 106 2.5e-11 PFAM
Blast:ARM 111 171 2e-25 BLAST
Blast:ARM 172 215 1e-15 BLAST
low complexity region 357 366 N/A INTRINSIC
low complexity region 375 393 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121949
SMART Domains Protein: ENSMUSP00000112812
Gene: ENSMUSG00000031657

DomainStartEndE-ValueType
Blast:ARM 1 54 7e-20 BLAST
Blast:ARM 55 98 8e-16 BLAST
low complexity region 240 249 N/A INTRINSIC
low complexity region 258 276 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene plays a role in ribosomal protein transport and in the assembly of the 5S ribonucleoprotein particle (5S RNP). The encoded protein also may be involved in NOD2-mediated NF-kappaB signaling. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 CTGCTG CTGCTGCATCCTGGGTTGCTG 4: 155,905,102 probably benign Het
AI837181 GGC GGCCGC 19: 5,425,226 probably benign Het
Arid1b GCG GCGTCG 17: 4,995,588 probably benign Het
Arid1b GGC GGCTGC 17: 4,995,596 probably benign Het
AY358078 CAGGT CAGGTAGGATAAGGT 14: 51,805,589 probably null Het
AY761185 GCACTGTGGGC G 8: 20,943,902 probably null Het
Bcar1 C A 8: 111,714,177 R395L possibly damaging Het
Begain CGCCGC CGCCGCGGCCGC 12: 109,033,424 probably benign Het
Cacna1f GAG GAGTAG X: 7,620,057 probably null Het
Calhm1 GC GCTGTGGCTGTGTC 19: 47,141,276 probably benign Het
Calhm1 C CTGTGAATGTGGA 19: 47,141,277 probably benign Het
Ccdc170 ACC ACCCCC 10: 4,561,026 probably benign Het
Cyb5r4 AGGGA AGGGATGTGACAGTCACACTGCCCTGGGA 9: 87,040,444 probably benign Het
Defb22 GCTGGCCT GCTGGCCTCTGCGGCAGACCTGGCCT 2: 152,485,823 probably benign Het
Defb22 CTGGC CTGGCGTTTGCGGCAGAGATGGC 2: 152,485,824 probably benign Het
Dnmt1 GGGCGGAGCACAGTTCCTACCTCGTT GGGCGGAGCACAGTTCCTACCTCGTTTTGGCGGCGGAGCACAGTTCCTACCTCGTT 9: 20,910,120 probably null Het
Dnmt1 CCTACCTCGTT CCTACCTCGTTTTGGGGGCGGAGAACAGTTTCTACCTCGTT 9: 20,910,135 probably null Het
Dock4 GTGCCGGTGCCGGT G 12: 40,844,393 probably null Het
Efhd2 CCGCC CCGCCGACGCC 4: 141,874,771 probably benign Het
Epha8 CCTGGGC CC 4: 136,933,037 probably benign Het
Eps8 CTCA CTCAATCA 6: 137,517,066 probably benign Het
Exd2 CAGCCAGAGC CAGC 12: 80,475,955 probably benign Het
Gab3 TCT TCTGCT X: 75,000,008 probably benign Het
Gm5475 GAAGGAAAGGT G 15: 100,427,152 probably null Het
Gm8369 TGTG TGTGCGTG 19: 11,511,773 probably null Het
Gm9573 CGGGGTAGGTGTAGATCCTGAGGCAGTGCTGGATGCAGGGGTGGTTGGGGTGGGTGTAGATCCTGAGGCAGTGCTGGATGCAG CGGGGTGGGTGTAGATCCTGAGGCAGTGCTGGATGCAG 17: 35,622,879 probably benign Het
Gpatch3 GGAG GG 4: 133,578,310 probably null Het
Hsdl2 GCAGGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGC GCAGGAGCAGCCACAGCTGCAGGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGC 4: 59,610,637 probably benign Het
Igf1r GATGGAGC GATGGAGCTGGATATGGAGC 7: 68,226,179 probably benign Het
Krtap28-10 AGCCACAGCCACCACAGCCACAGCCACCAC AGCCACAGCCACCACCGCCACAGCCACCACAGCCACAGCCACCAC 1: 83,042,258 probably benign Het
Las1l CTTCCT CTTCCTATTCCT X: 95,940,620 probably null Het
Lcmt1 GGC GGCCGCGGGGCGC 7: 123,369,834 probably null Het
Mamld1 AGC AGCCGC X: 71,118,826 probably benign Het
Map1a AGC AGCGCCAGCTCCAGCTCCAGCTCCAGCTCCCGC 2: 121,306,294 probably benign Het
Mdc1 CCCCCCCC CCCCCCCCCCCCCC 17: 35,854,407 probably benign Het
Mn1 CAG CAGTAG 5: 111,419,705 probably null Het
Morn4 GCAG GCAGGGAGTCAGTCAG 19: 42,076,111 probably null Het
Nefh CCTCAGCTGGGGACTTGG CCTCAGCTGGGGACTTGGGCTCAGCTGGGGACTTGG 11: 4,941,003 probably benign Het
Nefh GGG GGGTACTTGTCCTCACCTTGG 11: 4,941,029 probably benign Het
Padi3 TCTCAC TC 4: 140,792,972 probably benign Het
Pdik1l CCC CCCCACC 4: 134,286,594 probably null Het
Plekhs1 TCCAGAC TCCAGACCTCCCCCCAGAC 19: 56,479,858 probably benign Het
Rtbdn GCGGC GCGGCAACGGC 8: 84,956,175 probably benign Het
Sh3pxd2b TGTGCCTGT TGTGCCTGTGCCTGT 11: 32,423,057 probably benign Het
Slamf6 GAGTATTATTCTTTTGTTTGTTTGTTTGTTTGTTTGTTTACAG GAG 1: 171,941,582 probably benign Het
Tfeb GCAACA GCAACAACA 17: 47,786,088 probably benign Het
Zfp106 CTCCTGGCAGT CT 2: 120,524,545 probably benign Het
Znrd1as CACCACCACCACCACCACCAC CACCACCACCACCACCACCACAACCACCACCACCACCACCAC 17: 36,965,048 probably benign Het
Other mutations in Heatr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Heatr3 APN 8 88141739 missense possibly damaging 0.95
IGL00780:Heatr3 APN 8 88170940 missense probably benign 0.01
IGL01105:Heatr3 APN 8 88161893 missense probably benign 0.04
IGL01653:Heatr3 APN 8 88144617 missense probably benign
IGL02129:Heatr3 APN 8 88158271 splice site probably benign
IGL02145:Heatr3 APN 8 88144599 missense probably benign 0.40
IGL02177:Heatr3 APN 8 88156723 missense probably benign
IGL02309:Heatr3 APN 8 88167072 missense probably damaging 1.00
IGL02675:Heatr3 APN 8 88144557 missense possibly damaging 0.91
IGL03379:Heatr3 APN 8 88150110 missense probably benign 0.13
R0763:Heatr3 UTSW 8 88158241 missense probably damaging 1.00
R1244:Heatr3 UTSW 8 88141739 missense possibly damaging 0.95
R1883:Heatr3 UTSW 8 88144593 missense possibly damaging 0.95
R1988:Heatr3 UTSW 8 88150317 missense probably benign 0.02
R2043:Heatr3 UTSW 8 88147694 splice site probably benign
R2079:Heatr3 UTSW 8 88141776 missense probably damaging 0.99
R2402:Heatr3 UTSW 8 88144572 missense probably benign 0.33
R3916:Heatr3 UTSW 8 88150371 critical splice donor site probably null
R3917:Heatr3 UTSW 8 88150371 critical splice donor site probably null
R4127:Heatr3 UTSW 8 88138311 missense probably damaging 0.99
R4182:Heatr3 UTSW 8 88171002 utr 3 prime probably benign
R4190:Heatr3 UTSW 8 88138260 unclassified probably benign
R4769:Heatr3 UTSW 8 88141783 critical splice donor site probably null
R6046:Heatr3 UTSW 8 88139954 missense probably damaging 1.00
R6073:Heatr3 UTSW 8 88138140 missense probably benign 0.01
R6888:Heatr3 UTSW 8 88170884 missense probably damaging 1.00
R7284:Heatr3 UTSW 8 88156774 missense possibly damaging 0.69
RF031:Heatr3 UTSW 8 88156457 critical splice acceptor site probably benign
RF033:Heatr3 UTSW 8 88156456 critical splice acceptor site probably benign
RF040:Heatr3 UTSW 8 88156457 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- TGGAACACAGTTAACAGAGATTTGC -3'
(R):5'- ACTCATCATCCGAGGGATCTG -3'

Sequencing Primer
(F):5'- AGATTTGCTCTAGTGGACCAG -3'
(R):5'- CTGGGGTATCAAAGAAACTCCCATG -3'
Posted On2019-12-04