Incidental Mutation 'RF025:Sh3pxd2b'
ID604132
Institutional Source Beutler Lab
Gene Symbol Sh3pxd2b
Ensembl Gene ENSMUSG00000040711
Gene NameSH3 and PX domains 2B
SynonymsG431001E03Rik, Fad49, Tsk4
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.420) question?
Stock #RF025 (G1)
Quality Score214.458
Status Not validated
Chromosome11
Chromosomal Location32347820-32428173 bp(+) (GRCm38)
Type of Mutationsmall insertion (2 aa in frame mutation)
DNA Base Change (assembly) TGTGCCTGT to TGTGCCTGTGCCTGT at 32423057 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000044276 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038753]
Predicted Effect probably benign
Transcript: ENSMUST00000038753
SMART Domains Protein: ENSMUSP00000044276
Gene: ENSMUSG00000040711

DomainStartEndE-ValueType
PX 5 125 2.65e-30 SMART
SH3 155 210 1.11e-14 SMART
SH3 224 279 3.78e-17 SMART
SH3 371 426 2.33e-8 SMART
low complexity region 525 540 N/A INTRINSIC
low complexity region 748 772 N/A INTRINSIC
SH3 850 908 5.75e-8 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adapter protein that is characterized by a PX domain and four Src homology 3 domains. The encoded protein is required for podosome formation and is involved in cell adhesion and migration of numerous cell types. Mutations in this gene are the cause of Frank-ter Haar syndrome (FTHS), and also Borrone Dermato-Cardio-Skeletal (BDCS) syndrome. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit abnormal craniofacial morphology, decreased bone density, impaired hearing secondary to otis media, reduced growth, size, and weight, and decreased white adipose tissue. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 CTGCTG CTGCTGCATCCTGGGTTGCTG 4: 155,905,102 probably benign Het
AI837181 GGC GGCCGC 19: 5,425,226 probably benign Het
Arid1b GCG GCGTCG 17: 4,995,588 probably benign Het
Arid1b GGC GGCTGC 17: 4,995,596 probably benign Het
AY358078 CAGGT CAGGTAGGATAAGGT 14: 51,805,589 probably null Het
AY761185 GCACTGTGGGC G 8: 20,943,902 probably null Het
Bcar1 C A 8: 111,714,177 R395L possibly damaging Het
Begain CGCCGC CGCCGCGGCCGC 12: 109,033,424 probably benign Het
Cacna1f GAG GAGTAG X: 7,620,057 probably null Het
Calhm1 GC GCTGTGGCTGTGTC 19: 47,141,276 probably benign Het
Calhm1 C CTGTGAATGTGGA 19: 47,141,277 probably benign Het
Ccdc170 ACC ACCCCC 10: 4,561,026 probably benign Het
Cyb5r4 AGGGA AGGGATGTGACAGTCACACTGCCCTGGGA 9: 87,040,444 probably benign Het
Defb22 GCTGGCCT GCTGGCCTCTGCGGCAGACCTGGCCT 2: 152,485,823 probably benign Het
Defb22 CTGGC CTGGCGTTTGCGGCAGAGATGGC 2: 152,485,824 probably benign Het
Dnmt1 GGGCGGAGCACAGTTCCTACCTCGTT GGGCGGAGCACAGTTCCTACCTCGTTTTGGCGGCGGAGCACAGTTCCTACCTCGTT 9: 20,910,120 probably null Het
Dnmt1 CCTACCTCGTT CCTACCTCGTTTTGGGGGCGGAGAACAGTTTCTACCTCGTT 9: 20,910,135 probably null Het
Dock4 GTGCCGGTGCCGGT G 12: 40,844,393 probably null Het
Efhd2 CCGCC CCGCCGACGCC 4: 141,874,771 probably benign Het
Epha8 CCTGGGC CC 4: 136,933,037 probably benign Het
Eps8 CTCA CTCAATCA 6: 137,517,066 probably benign Het
Exd2 CAGCCAGAGC CAGC 12: 80,475,955 probably benign Het
Gab3 TCT TCTGCT X: 75,000,008 probably benign Het
Gm5475 GAAGGAAAGGT G 15: 100,427,152 probably null Het
Gm8369 TGTG TGTGCGTG 19: 11,511,773 probably null Het
Gm9573 CGGGGTAGGTGTAGATCCTGAGGCAGTGCTGGATGCAGGGGTGGTTGGGGTGGGTGTAGATCCTGAGGCAGTGCTGGATGCAG CGGGGTGGGTGTAGATCCTGAGGCAGTGCTGGATGCAG 17: 35,622,879 probably benign Het
Gpatch3 GGAG GG 4: 133,578,310 probably null Het
Heatr3 TTAT TTATGTAT 8: 88,156,456 probably benign Het
Hsdl2 GCAGGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGC GCAGGAGCAGCCACAGCTGCAGGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGC 4: 59,610,637 probably benign Het
Igf1r GATGGAGC GATGGAGCTGGATATGGAGC 7: 68,226,179 probably benign Het
Krtap28-10 AGCCACAGCCACCACAGCCACAGCCACCAC AGCCACAGCCACCACCGCCACAGCCACCACAGCCACAGCCACCAC 1: 83,042,258 probably benign Het
Las1l CTTCCT CTTCCTATTCCT X: 95,940,620 probably null Het
Lcmt1 GGC GGCCGCGGGGCGC 7: 123,369,834 probably null Het
Mamld1 AGC AGCCGC X: 71,118,826 probably benign Het
Map1a AGC AGCGCCAGCTCCAGCTCCAGCTCCAGCTCCCGC 2: 121,306,294 probably benign Het
Mdc1 CCCCCCCC CCCCCCCCCCCCCC 17: 35,854,407 probably benign Het
Mn1 CAG CAGTAG 5: 111,419,705 probably null Het
Morn4 GCAG GCAGGGAGTCAGTCAG 19: 42,076,111 probably null Het
Nefh CCTCAGCTGGGGACTTGG CCTCAGCTGGGGACTTGGGCTCAGCTGGGGACTTGG 11: 4,941,003 probably benign Het
Nefh GGG GGGTACTTGTCCTCACCTTGG 11: 4,941,029 probably benign Het
Padi3 TCTCAC TC 4: 140,792,972 probably benign Het
Pdik1l CCC CCCCACC 4: 134,286,594 probably null Het
Plekhs1 TCCAGAC TCCAGACCTCCCCCCAGAC 19: 56,479,858 probably benign Het
Rtbdn GCGGC GCGGCAACGGC 8: 84,956,175 probably benign Het
Slamf6 GAGTATTATTCTTTTGTTTGTTTGTTTGTTTGTTTGTTTACAG GAG 1: 171,941,582 probably benign Het
Tfeb GCAACA GCAACAACA 17: 47,786,088 probably benign Het
Zfp106 CTCCTGGCAGT CT 2: 120,524,545 probably benign Het
Znrd1as CACCACCACCACCACCACCAC CACCACCACCACCACCACCACAACCACCACCACCACCACCAC 17: 36,965,048 probably benign Het
Other mutations in Sh3pxd2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Sh3pxd2b APN 11 32403993 nonsense probably null
IGL01581:Sh3pxd2b APN 11 32387973 missense possibly damaging 0.64
IGL02067:Sh3pxd2b APN 11 32423095 missense probably benign 0.01
IGL02412:Sh3pxd2b APN 11 32387992 missense probably damaging 0.99
IGL02930:Sh3pxd2b APN 11 32417161 missense possibly damaging 0.91
IGL03299:Sh3pxd2b APN 11 32411448 splice site probably benign
IGL03378:Sh3pxd2b APN 11 32381443 missense probably damaging 1.00
FR4449:Sh3pxd2b UTSW 11 32423065 small insertion probably benign
FR4548:Sh3pxd2b UTSW 11 32423064 small insertion probably benign
FR4548:Sh3pxd2b UTSW 11 32423065 small insertion probably benign
FR4976:Sh3pxd2b UTSW 11 32423055 small insertion probably benign
FR4976:Sh3pxd2b UTSW 11 32423060 small insertion probably benign
R0097:Sh3pxd2b UTSW 11 32403978 missense probably damaging 1.00
R0097:Sh3pxd2b UTSW 11 32403978 missense probably damaging 1.00
R0441:Sh3pxd2b UTSW 11 32423023 missense possibly damaging 0.77
R0715:Sh3pxd2b UTSW 11 32423341 missense possibly damaging 0.93
R1456:Sh3pxd2b UTSW 11 32415967 missense probably damaging 1.00
R1616:Sh3pxd2b UTSW 11 32381441 missense possibly damaging 0.90
R1748:Sh3pxd2b UTSW 11 32422203 missense possibly damaging 0.92
R1902:Sh3pxd2b UTSW 11 32423559 makesense probably null
R1977:Sh3pxd2b UTSW 11 32422138 missense probably damaging 1.00
R3761:Sh3pxd2b UTSW 11 32422750 missense probably benign 0.45
R3850:Sh3pxd2b UTSW 11 32411505 missense probably damaging 1.00
R4060:Sh3pxd2b UTSW 11 32422263 missense probably benign 0.16
R4062:Sh3pxd2b UTSW 11 32422263 missense probably benign 0.16
R4064:Sh3pxd2b UTSW 11 32422263 missense probably benign 0.16
R4585:Sh3pxd2b UTSW 11 32396479 missense possibly damaging 0.84
R5278:Sh3pxd2b UTSW 11 32381447 missense probably damaging 1.00
R5652:Sh3pxd2b UTSW 11 32422812 missense probably damaging 1.00
R5827:Sh3pxd2b UTSW 11 32422422 missense probably benign 0.01
R5994:Sh3pxd2b UTSW 11 32407570 missense probably damaging 1.00
R6083:Sh3pxd2b UTSW 11 32422985 missense probably benign 0.30
R6392:Sh3pxd2b UTSW 11 32423302 missense possibly damaging 0.74
R6625:Sh3pxd2b UTSW 11 32422594 missense possibly damaging 0.74
R6649:Sh3pxd2b UTSW 11 32415978 splice site probably null
R7056:Sh3pxd2b UTSW 11 32422737 missense probably benign 0.01
R7131:Sh3pxd2b UTSW 11 32422072 missense probably damaging 1.00
R7192:Sh3pxd2b UTSW 11 32414318 missense probably damaging 1.00
R7911:Sh3pxd2b UTSW 11 32371533 missense probably damaging 1.00
R7992:Sh3pxd2b UTSW 11 32371533 missense probably damaging 1.00
R8026:Sh3pxd2b UTSW 11 32411567 missense probably damaging 1.00
R8027:Sh3pxd2b UTSW 11 32422210 missense probably benign 0.01
RF016:Sh3pxd2b UTSW 11 32423053 small insertion probably benign
RF022:Sh3pxd2b UTSW 11 32423054 small insertion probably benign
RF040:Sh3pxd2b UTSW 11 32423055 small insertion probably benign
RF056:Sh3pxd2b UTSW 11 32423055 small insertion probably benign
RF063:Sh3pxd2b UTSW 11 32423051 small insertion probably benign
X0017:Sh3pxd2b UTSW 11 32414359 missense possibly damaging 0.94
X0028:Sh3pxd2b UTSW 11 32423110 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGAAAGCCACCATGCTGCTG -3'
(R):5'- TTGGCCCACTGAGGAGTTAGAG -3'

Sequencing Primer
(F):5'- TGCTGGGAGCCATGACACAG -3'
(R):5'- TGGCTTTTGGAGGGACAAGGAG -3'
Posted On2019-12-04