Incidental Mutation 'RF025:Exd2'
ID604134
Institutional Source Beutler Lab
Gene Symbol Exd2
Ensembl Gene ENSMUSG00000032705
Gene Nameexonuclease 3'-5' domain containing 2
Synonyms4930539P14Rik, Exdl2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #RF025 (G1)
Quality Score217.468
Status Not validated
Chromosome12
Chromosomal Location80463095-80500227 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) CAGCCAGAGC to CAGC at 80475955 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038185] [ENSMUST00000219272]
Predicted Effect probably benign
Transcript: ENSMUST00000038185
SMART Domains Protein: ENSMUSP00000043049
Gene: ENSMUSG00000032705

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 40 72 N/A INTRINSIC
35EXOc 105 291 3.8e-10 SMART
Blast:HNHc 438 492 1e-6 BLAST
low complexity region 517 532 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219272
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 CTGCTG CTGCTGCATCCTGGGTTGCTG 4: 155,905,102 probably benign Het
AI837181 GGC GGCCGC 19: 5,425,226 probably benign Het
Arid1b GCG GCGTCG 17: 4,995,588 probably benign Het
Arid1b GGC GGCTGC 17: 4,995,596 probably benign Het
AY358078 CAGGT CAGGTAGGATAAGGT 14: 51,805,589 probably null Het
AY761185 GCACTGTGGGC G 8: 20,943,902 probably null Het
Bcar1 C A 8: 111,714,177 R395L possibly damaging Het
Begain CGCCGC CGCCGCGGCCGC 12: 109,033,424 probably benign Het
Cacna1f GAG GAGTAG X: 7,620,057 probably null Het
Calhm1 GC GCTGTGGCTGTGTC 19: 47,141,276 probably benign Het
Calhm1 C CTGTGAATGTGGA 19: 47,141,277 probably benign Het
Ccdc170 ACC ACCCCC 10: 4,561,026 probably benign Het
Cyb5r4 AGGGA AGGGATGTGACAGTCACACTGCCCTGGGA 9: 87,040,444 probably benign Het
Defb22 GCTGGCCT GCTGGCCTCTGCGGCAGACCTGGCCT 2: 152,485,823 probably benign Het
Defb22 CTGGC CTGGCGTTTGCGGCAGAGATGGC 2: 152,485,824 probably benign Het
Dnmt1 GGGCGGAGCACAGTTCCTACCTCGTT GGGCGGAGCACAGTTCCTACCTCGTTTTGGCGGCGGAGCACAGTTCCTACCTCGTT 9: 20,910,120 probably null Het
Dnmt1 CCTACCTCGTT CCTACCTCGTTTTGGGGGCGGAGAACAGTTTCTACCTCGTT 9: 20,910,135 probably null Het
Dock4 GTGCCGGTGCCGGT G 12: 40,844,393 probably null Het
Efhd2 CCGCC CCGCCGACGCC 4: 141,874,771 probably benign Het
Epha8 CCTGGGC CC 4: 136,933,037 probably benign Het
Eps8 CTCA CTCAATCA 6: 137,517,066 probably benign Het
Gab3 TCT TCTGCT X: 75,000,008 probably benign Het
Gm5475 GAAGGAAAGGT G 15: 100,427,152 probably null Het
Gm8369 TGTG TGTGCGTG 19: 11,511,773 probably null Het
Gm9573 CGGGGTAGGTGTAGATCCTGAGGCAGTGCTGGATGCAGGGGTGGTTGGGGTGGGTGTAGATCCTGAGGCAGTGCTGGATGCAG CGGGGTGGGTGTAGATCCTGAGGCAGTGCTGGATGCAG 17: 35,622,879 probably benign Het
Gpatch3 GGAG GG 4: 133,578,310 probably null Het
Heatr3 TTAT TTATGTAT 8: 88,156,456 probably benign Het
Hsdl2 GCAGGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGC GCAGGAGCAGCCACAGCTGCAGGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGC 4: 59,610,637 probably benign Het
Igf1r GATGGAGC GATGGAGCTGGATATGGAGC 7: 68,226,179 probably benign Het
Krtap28-10 AGCCACAGCCACCACAGCCACAGCCACCAC AGCCACAGCCACCACCGCCACAGCCACCACAGCCACAGCCACCAC 1: 83,042,258 probably benign Het
Las1l CTTCCT CTTCCTATTCCT X: 95,940,620 probably null Het
Lcmt1 GGC GGCCGCGGGGCGC 7: 123,369,834 probably null Het
Mamld1 AGC AGCCGC X: 71,118,826 probably benign Het
Map1a AGC AGCGCCAGCTCCAGCTCCAGCTCCAGCTCCCGC 2: 121,306,294 probably benign Het
Mdc1 CCCCCCCC CCCCCCCCCCCCCC 17: 35,854,407 probably benign Het
Mn1 CAG CAGTAG 5: 111,419,705 probably null Het
Morn4 GCAG GCAGGGAGTCAGTCAG 19: 42,076,111 probably null Het
Nefh CCTCAGCTGGGGACTTGG CCTCAGCTGGGGACTTGGGCTCAGCTGGGGACTTGG 11: 4,941,003 probably benign Het
Nefh GGG GGGTACTTGTCCTCACCTTGG 11: 4,941,029 probably benign Het
Padi3 TCTCAC TC 4: 140,792,972 probably benign Het
Pdik1l CCC CCCCACC 4: 134,286,594 probably null Het
Plekhs1 TCCAGAC TCCAGACCTCCCCCCAGAC 19: 56,479,858 probably benign Het
Rtbdn GCGGC GCGGCAACGGC 8: 84,956,175 probably benign Het
Sh3pxd2b TGTGCCTGT TGTGCCTGTGCCTGT 11: 32,423,057 probably benign Het
Slamf6 GAGTATTATTCTTTTGTTTGTTTGTTTGTTTGTTTGTTTACAG GAG 1: 171,941,582 probably benign Het
Tfeb GCAACA GCAACAACA 17: 47,786,088 probably benign Het
Zfp106 CTCCTGGCAGT CT 2: 120,524,545 probably benign Het
Znrd1as CACCACCACCACCACCACCAC CACCACCACCACCACCACCACAACCACCACCACCACCACCAC 17: 36,965,048 probably benign Het
Other mutations in Exd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Exd2 APN 12 80476166 missense probably damaging 1.00
IGL00546:Exd2 APN 12 80480547 missense probably benign 0.05
IGL02964:Exd2 APN 12 80480528 missense probably damaging 0.99
IGL03036:Exd2 APN 12 80489411 missense probably damaging 1.00
R0304:Exd2 UTSW 12 80491240 unclassified probably benign
R0436:Exd2 UTSW 12 80490770 splice site probably benign
R1290:Exd2 UTSW 12 80484326 missense probably benign 0.00
R1772:Exd2 UTSW 12 80489479 missense probably benign 0.00
R2102:Exd2 UTSW 12 80480603 missense possibly damaging 0.78
R2104:Exd2 UTSW 12 80496801 missense probably benign 0.01
R2408:Exd2 UTSW 12 80484241 splice site probably benign
R3693:Exd2 UTSW 12 80480693 missense probably damaging 1.00
R4748:Exd2 UTSW 12 80480576 missense probably damaging 1.00
R4773:Exd2 UTSW 12 80475818 missense possibly damaging 0.46
R5022:Exd2 UTSW 12 80496790 missense probably damaging 1.00
R5057:Exd2 UTSW 12 80496790 missense probably damaging 1.00
R5179:Exd2 UTSW 12 80484344 missense probably damaging 1.00
R5377:Exd2 UTSW 12 80489448 missense probably damaging 1.00
R7246:Exd2 UTSW 12 80480535 missense probably damaging 1.00
R7761:Exd2 UTSW 12 80475772 missense probably damaging 0.98
R7776:Exd2 UTSW 12 80492560 missense probably damaging 1.00
R8032:Exd2 UTSW 12 80489653 missense probably benign 0.00
RF013:Exd2 UTSW 12 80475932 frame shift probably null
RF015:Exd2 UTSW 12 80475917 intron probably benign
RF022:Exd2 UTSW 12 80475917 intron probably benign
RF023:Exd2 UTSW 12 80475915 intron probably benign
RF029:Exd2 UTSW 12 80475946 frame shift probably null
RF035:Exd2 UTSW 12 80475900 intron probably benign
RF035:Exd2 UTSW 12 80475955 intron probably benign
RF039:Exd2 UTSW 12 80475941 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGTGGCTTTGACAGTGACCAC -3'
(R):5'- CATTCACAGTCAATTCCAAGTACAGG -3'

Sequencing Primer
(F):5'- TGACAGTGACCACCCTTCTGG -3'
(R):5'- AAAGGGCTGGATTTGATTCCACTC -3'
Posted On2019-12-04