Incidental Mutation 'RF025:Gm5475'
ID604137
Institutional Source Beutler Lab
Gene Symbol Gm5475
Ensembl Gene ENSMUSG00000087444
Gene Namepredicted gene 5475
Synonyms
Accession Numbers

Ensembl: ENSMUST00000148928, ENSMUST00000132119; MGI:3646320

Is this an essential gene? Possibly non essential (E-score: 0.411) question?
Stock #RF025 (G1)
Quality Score217.468
Status Not validated
Chromosome15
Chromosomal Location100422147-100428150 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GAAGGAAAGGT to G at 100427152 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023774] [ENSMUST00000123461] [ENSMUST00000132119] [ENSMUST00000136168] [ENSMUST00000138843] [ENSMUST00000148928] [ENSMUST00000154331] [ENSMUST00000154676]
Predicted Effect probably benign
Transcript: ENSMUST00000023774
SMART Domains Protein: ENSMUSP00000023774
Gene: ENSMUSG00000023030

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
Pfam:Nramp 90 474 1.1e-122 PFAM
transmembrane domain 505 527 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123461
SMART Domains Protein: ENSMUSP00000119056
Gene: ENSMUSG00000023030

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
Pfam:Nramp 90 170 2.9e-31 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000132119
SMART Domains Protein: ENSMUSP00000114783
Gene: ENSMUSG00000087444

DomainStartEndE-ValueType
low complexity region 23 33 N/A INTRINSIC
low complexity region 71 83 N/A INTRINSIC
low complexity region 144 168 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136168
Predicted Effect probably benign
Transcript: ENSMUST00000138843
SMART Domains Protein: ENSMUSP00000116463
Gene: ENSMUSG00000023030

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
Pfam:Nramp 90 474 4.7e-118 PFAM
transmembrane domain 505 527 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148928
SMART Domains Protein: ENSMUSP00000114462
Gene: ENSMUSG00000087444

DomainStartEndE-ValueType
low complexity region 23 33 N/A INTRINSIC
low complexity region 71 83 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154331
SMART Domains Protein: ENSMUSP00000115357
Gene: ENSMUSG00000023030

DomainStartEndE-ValueType
low complexity region 41 56 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154676
SMART Domains Protein: ENSMUSP00000115019
Gene: ENSMUSG00000023030

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 CTGCTG CTGCTGCATCCTGGGTTGCTG 4: 155,905,102 probably benign Het
AI837181 GGC GGCCGC 19: 5,425,226 probably benign Het
Arid1b GCG GCGTCG 17: 4,995,588 probably benign Het
Arid1b GGC GGCTGC 17: 4,995,596 probably benign Het
AY358078 CAGGT CAGGTAGGATAAGGT 14: 51,805,589 probably null Het
AY761185 GCACTGTGGGC G 8: 20,943,902 probably null Het
Bcar1 C A 8: 111,714,177 R395L possibly damaging Het
Begain CGCCGC CGCCGCGGCCGC 12: 109,033,424 probably benign Het
Cacna1f GAG GAGTAG X: 7,620,057 probably null Het
Calhm1 GC GCTGTGGCTGTGTC 19: 47,141,276 probably benign Het
Calhm1 C CTGTGAATGTGGA 19: 47,141,277 probably benign Het
Ccdc170 ACC ACCCCC 10: 4,561,026 probably benign Het
Cyb5r4 AGGGA AGGGATGTGACAGTCACACTGCCCTGGGA 9: 87,040,444 probably benign Het
Defb22 GCTGGCCT GCTGGCCTCTGCGGCAGACCTGGCCT 2: 152,485,823 probably benign Het
Defb22 CTGGC CTGGCGTTTGCGGCAGAGATGGC 2: 152,485,824 probably benign Het
Dnmt1 GGGCGGAGCACAGTTCCTACCTCGTT GGGCGGAGCACAGTTCCTACCTCGTTTTGGCGGCGGAGCACAGTTCCTACCTCGTT 9: 20,910,120 probably null Het
Dnmt1 CCTACCTCGTT CCTACCTCGTTTTGGGGGCGGAGAACAGTTTCTACCTCGTT 9: 20,910,135 probably null Het
Dock4 GTGCCGGTGCCGGT G 12: 40,844,393 probably null Het
Efhd2 CCGCC CCGCCGACGCC 4: 141,874,771 probably benign Het
Epha8 CCTGGGC CC 4: 136,933,037 probably benign Het
Eps8 CTCA CTCAATCA 6: 137,517,066 probably benign Het
Exd2 CAGCCAGAGC CAGC 12: 80,475,955 probably benign Het
Gab3 TCT TCTGCT X: 75,000,008 probably benign Het
Gm8369 TGTG TGTGCGTG 19: 11,511,773 probably null Het
Gm9573 CGGGGTAGGTGTAGATCCTGAGGCAGTGCTGGATGCAGGGGTGGTTGGGGTGGGTGTAGATCCTGAGGCAGTGCTGGATGCAG CGGGGTGGGTGTAGATCCTGAGGCAGTGCTGGATGCAG 17: 35,622,879 probably benign Het
Gpatch3 GGAG GG 4: 133,578,310 probably null Het
Heatr3 TTAT TTATGTAT 8: 88,156,456 probably benign Het
Hsdl2 GCAGGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGC GCAGGAGCAGCCACAGCTGCAGGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGC 4: 59,610,637 probably benign Het
Igf1r GATGGAGC GATGGAGCTGGATATGGAGC 7: 68,226,179 probably benign Het
Krtap28-10 AGCCACAGCCACCACAGCCACAGCCACCAC AGCCACAGCCACCACCGCCACAGCCACCACAGCCACAGCCACCAC 1: 83,042,258 probably benign Het
Las1l CTTCCT CTTCCTATTCCT X: 95,940,620 probably null Het
Lcmt1 GGC GGCCGCGGGGCGC 7: 123,369,834 probably null Het
Mamld1 AGC AGCCGC X: 71,118,826 probably benign Het
Map1a AGC AGCGCCAGCTCCAGCTCCAGCTCCAGCTCCCGC 2: 121,306,294 probably benign Het
Mdc1 CCCCCCCC CCCCCCCCCCCCCC 17: 35,854,407 probably benign Het
Mn1 CAG CAGTAG 5: 111,419,705 probably null Het
Morn4 GCAG GCAGGGAGTCAGTCAG 19: 42,076,111 probably null Het
Nefh CCTCAGCTGGGGACTTGG CCTCAGCTGGGGACTTGGGCTCAGCTGGGGACTTGG 11: 4,941,003 probably benign Het
Nefh GGG GGGTACTTGTCCTCACCTTGG 11: 4,941,029 probably benign Het
Padi3 TCTCAC TC 4: 140,792,972 probably benign Het
Pdik1l CCC CCCCACC 4: 134,286,594 probably null Het
Plekhs1 TCCAGAC TCCAGACCTCCCCCCAGAC 19: 56,479,858 probably benign Het
Rtbdn GCGGC GCGGCAACGGC 8: 84,956,175 probably benign Het
Sh3pxd2b TGTGCCTGT TGTGCCTGTGCCTGT 11: 32,423,057 probably benign Het
Slamf6 GAGTATTATTCTTTTGTTTGTTTGTTTGTTTGTTTGTTTACAG GAG 1: 171,941,582 probably benign Het
Tfeb GCAACA GCAACAACA 17: 47,786,088 probably benign Het
Zfp106 CTCCTGGCAGT CT 2: 120,524,545 probably benign Het
Znrd1as CACCACCACCACCACCACCAC CACCACCACCACCACCACCACAACCACCACCACCACCACCAC 17: 36,965,048 probably benign Het
Other mutations in Gm5475
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01139:Gm5475 APN 15 100424215 unclassified probably benign
R0037:Gm5475 UTSW 15 100424202 nonsense probably null
R2219:Gm5475 UTSW 15 100424213 unclassified probably benign
R4258:Gm5475 UTSW 15 100424236 unclassified probably benign
R6934:Gm5475 UTSW 15 100427126 unclassified probably benign
R7269:Gm5475 UTSW 15 100427009 missense unknown
R8093:Gm5475 UTSW 15 100424012 missense unknown
RF020:Gm5475 UTSW 15 100427149 frame shift probably null
RF030:Gm5475 UTSW 15 100427156 frame shift probably null
RF031:Gm5475 UTSW 15 100427148 frame shift probably null
RF033:Gm5475 UTSW 15 100427144 frame shift probably null
RF047:Gm5475 UTSW 15 100427156 frame shift probably null
X0028:Gm5475 UTSW 15 100424239 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CCATCTTTTCCTGGAAAATCGG -3'
(R):5'- AGTGAGAAATGCTTGCAATTCC -3'

Sequencing Primer
(F):5'- ATCGGAAAATCGTTCTTCAGGG -3'
(R):5'- CAACCAGAGGGATTTTTGCC -3'
Posted On2019-12-04