Incidental Mutation 'RF025:Mdc1'
ID604141
Institutional Source Beutler Lab
Gene Symbol Mdc1
Ensembl Gene ENSMUSG00000061607
Gene Namemediator of DNA damage checkpoint 1
SynonymsNFBD1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #RF025 (G1)
Quality Score178.593
Status Not validated
Chromosome17
Chromosomal Location35841515-35859670 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) CCCCCCCC to CCCCCCCCCCCCCC at 35854407 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000080949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082337]
Predicted Effect probably benign
Transcript: ENSMUST00000082337
SMART Domains Protein: ENSMUSP00000080949
Gene: ENSMUSG00000061607

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
FHA 53 105 5.63e-9 SMART
low complexity region 194 215 N/A INTRINSIC
low complexity region 854 870 N/A INTRINSIC
low complexity region 969 987 N/A INTRINSIC
low complexity region 1008 1022 N/A INTRINSIC
internal_repeat_1 1027 1115 6.7e-11 PROSPERO
internal_repeat_2 1030 1141 2.36e-9 PROSPERO
internal_repeat_1 1266 1354 6.7e-11 PROSPERO
internal_repeat_2 1298 1417 2.36e-9 PROSPERO
low complexity region 1422 1445 N/A INTRINSIC
low complexity region 1457 1477 N/A INTRINSIC
BRCT 1502 1579 1.66e-1 SMART
BRCT 1612 1691 2.45e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000225192
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene contains an N-terminal forkhead domain, two BRCA1 C-terminal (BRCT) motifs and a central domain with 7 divergent copies of an approximately 41-amino acid sequence. The encoded protein is required to activate the intra-S phase and G2/M phase cell cycle checkpoints in response to DNA damage. This nuclear protein interacts with phosphorylated histone H2AX near sites of DNA double-strand breaks through its BRCT motifs, and facilitates recruitment of the ATM kinase and meiotic recombination 11 protein complex to DNA damage foci. Mice with mutations in this gene exhibit growth retardation, male infertility, immune defects, chromosome instability, DNA repair defects, and radiation sensitivity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are smaller and display increased susceptibility to ionizing radiation, male infertility, T and B cell abnormalities, and increased genomic instability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 CTGCTG CTGCTGCATCCTGGGTTGCTG 4: 155,905,102 probably benign Het
AI837181 GGC GGCCGC 19: 5,425,226 probably benign Het
Arid1b GCG GCGTCG 17: 4,995,588 probably benign Het
Arid1b GGC GGCTGC 17: 4,995,596 probably benign Het
AY358078 CAGGT CAGGTAGGATAAGGT 14: 51,805,589 probably null Het
AY761185 GCACTGTGGGC G 8: 20,943,902 probably null Het
Bcar1 C A 8: 111,714,177 R395L possibly damaging Het
Begain CGCCGC CGCCGCGGCCGC 12: 109,033,424 probably benign Het
Cacna1f GAG GAGTAG X: 7,620,057 probably null Het
Calhm1 GC GCTGTGGCTGTGTC 19: 47,141,276 probably benign Het
Calhm1 C CTGTGAATGTGGA 19: 47,141,277 probably benign Het
Ccdc170 ACC ACCCCC 10: 4,561,026 probably benign Het
Cyb5r4 AGGGA AGGGATGTGACAGTCACACTGCCCTGGGA 9: 87,040,444 probably benign Het
Defb22 GCTGGCCT GCTGGCCTCTGCGGCAGACCTGGCCT 2: 152,485,823 probably benign Het
Defb22 CTGGC CTGGCGTTTGCGGCAGAGATGGC 2: 152,485,824 probably benign Het
Dnmt1 GGGCGGAGCACAGTTCCTACCTCGTT GGGCGGAGCACAGTTCCTACCTCGTTTTGGCGGCGGAGCACAGTTCCTACCTCGTT 9: 20,910,120 probably null Het
Dnmt1 CCTACCTCGTT CCTACCTCGTTTTGGGGGCGGAGAACAGTTTCTACCTCGTT 9: 20,910,135 probably null Het
Dock4 GTGCCGGTGCCGGT G 12: 40,844,393 probably null Het
Efhd2 CCGCC CCGCCGACGCC 4: 141,874,771 probably benign Het
Epha8 CCTGGGC CC 4: 136,933,037 probably benign Het
Eps8 CTCA CTCAATCA 6: 137,517,066 probably benign Het
Exd2 CAGCCAGAGC CAGC 12: 80,475,955 probably benign Het
Gab3 TCT TCTGCT X: 75,000,008 probably benign Het
Gm5475 GAAGGAAAGGT G 15: 100,427,152 probably null Het
Gm8369 TGTG TGTGCGTG 19: 11,511,773 probably null Het
Gm9573 CGGGGTAGGTGTAGATCCTGAGGCAGTGCTGGATGCAGGGGTGGTTGGGGTGGGTGTAGATCCTGAGGCAGTGCTGGATGCAG CGGGGTGGGTGTAGATCCTGAGGCAGTGCTGGATGCAG 17: 35,622,879 probably benign Het
Gpatch3 GGAG GG 4: 133,578,310 probably null Het
Heatr3 TTAT TTATGTAT 8: 88,156,456 probably benign Het
Hsdl2 GCAGGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGC GCAGGAGCAGCCACAGCTGCAGGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGC 4: 59,610,637 probably benign Het
Igf1r GATGGAGC GATGGAGCTGGATATGGAGC 7: 68,226,179 probably benign Het
Krtap28-10 AGCCACAGCCACCACAGCCACAGCCACCAC AGCCACAGCCACCACCGCCACAGCCACCACAGCCACAGCCACCAC 1: 83,042,258 probably benign Het
Las1l CTTCCT CTTCCTATTCCT X: 95,940,620 probably null Het
Lcmt1 GGC GGCCGCGGGGCGC 7: 123,369,834 probably null Het
Mamld1 AGC AGCCGC X: 71,118,826 probably benign Het
Map1a AGC AGCGCCAGCTCCAGCTCCAGCTCCAGCTCCCGC 2: 121,306,294 probably benign Het
Mn1 CAG CAGTAG 5: 111,419,705 probably null Het
Morn4 GCAG GCAGGGAGTCAGTCAG 19: 42,076,111 probably null Het
Nefh CCTCAGCTGGGGACTTGG CCTCAGCTGGGGACTTGGGCTCAGCTGGGGACTTGG 11: 4,941,003 probably benign Het
Nefh GGG GGGTACTTGTCCTCACCTTGG 11: 4,941,029 probably benign Het
Padi3 TCTCAC TC 4: 140,792,972 probably benign Het
Pdik1l CCC CCCCACC 4: 134,286,594 probably null Het
Plekhs1 TCCAGAC TCCAGACCTCCCCCCAGAC 19: 56,479,858 probably benign Het
Rtbdn GCGGC GCGGCAACGGC 8: 84,956,175 probably benign Het
Sh3pxd2b TGTGCCTGT TGTGCCTGTGCCTGT 11: 32,423,057 probably benign Het
Slamf6 GAGTATTATTCTTTTGTTTGTTTGTTTGTTTGTTTGTTTACAG GAG 1: 171,941,582 probably benign Het
Tfeb GCAACA GCAACAACA 17: 47,786,088 probably benign Het
Zfp106 CTCCTGGCAGT CT 2: 120,524,545 probably benign Het
Znrd1as CACCACCACCACCACCACCAC CACCACCACCACCACCACCACAACCACCACCACCACCACCAC 17: 36,965,048 probably benign Het
Other mutations in Mdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Mdc1 APN 17 35848020 missense probably benign 0.04
IGL01662:Mdc1 APN 17 35852505 missense probably benign 0.00
IGL01931:Mdc1 APN 17 35848231 missense probably benign 0.00
IGL02542:Mdc1 APN 17 35853156 missense probably damaging 0.96
IGL02823:Mdc1 APN 17 35852923 missense probably damaging 0.99
IGL03411:Mdc1 APN 17 35853126 missense probably benign 0.06
IGL02799:Mdc1 UTSW 17 35846191 missense possibly damaging 0.86
PIT4362001:Mdc1 UTSW 17 35844469 missense possibly damaging 0.72
R0054:Mdc1 UTSW 17 35849033 missense probably benign 0.00
R0129:Mdc1 UTSW 17 35854445 missense probably benign 0.04
R0131:Mdc1 UTSW 17 35852581 missense probably damaging 0.99
R0131:Mdc1 UTSW 17 35852581 missense probably damaging 0.99
R0132:Mdc1 UTSW 17 35852581 missense probably damaging 0.99
R1406:Mdc1 UTSW 17 35853532 missense probably benign 0.10
R1406:Mdc1 UTSW 17 35853532 missense probably benign 0.10
R1597:Mdc1 UTSW 17 35845866 missense probably damaging 1.00
R1721:Mdc1 UTSW 17 35847826 missense possibly damaging 0.85
R1888:Mdc1 UTSW 17 35854225 missense probably benign 0.03
R1888:Mdc1 UTSW 17 35854225 missense probably benign 0.03
R1912:Mdc1 UTSW 17 35844538 missense probably benign 0.00
R1912:Mdc1 UTSW 17 35850811 missense probably benign 0.19
R1977:Mdc1 UTSW 17 35850930 missense probably benign 0.01
R2121:Mdc1 UTSW 17 35847943 missense probably benign 0.03
R2122:Mdc1 UTSW 17 35847943 missense probably benign 0.03
R2357:Mdc1 UTSW 17 35847445 missense probably benign 0.00
R2842:Mdc1 UTSW 17 35848794 missense probably benign 0.01
R2851:Mdc1 UTSW 17 35849010 missense probably benign 0.04
R2852:Mdc1 UTSW 17 35849010 missense probably benign 0.04
R2964:Mdc1 UTSW 17 35853637 missense possibly damaging 0.72
R2996:Mdc1 UTSW 17 35847893 unclassified probably benign
R3752:Mdc1 UTSW 17 35845929 missense probably damaging 1.00
R4234:Mdc1 UTSW 17 35848824 missense probably benign 0.00
R4641:Mdc1 UTSW 17 35857469 missense probably benign 0.09
R4706:Mdc1 UTSW 17 35852779 missense probably damaging 0.99
R4809:Mdc1 UTSW 17 35849101 critical splice donor site probably null
R4833:Mdc1 UTSW 17 35850394 missense probably benign 0.20
R5032:Mdc1 UTSW 17 35850589 missense probably benign 0.00
R5047:Mdc1 UTSW 17 35847844 missense probably benign 0.00
R5086:Mdc1 UTSW 17 35848630 missense probably benign 0.00
R5172:Mdc1 UTSW 17 35853090 missense probably benign 0.00
R5254:Mdc1 UTSW 17 35847922 missense probably benign 0.00
R5473:Mdc1 UTSW 17 35848060 missense probably benign 0.01
R5550:Mdc1 UTSW 17 35845884 missense possibly damaging 0.64
R5561:Mdc1 UTSW 17 35848546 missense probably benign 0.00
R5888:Mdc1 UTSW 17 35847820 missense probably benign 0.01
R6020:Mdc1 UTSW 17 35848633 missense probably benign 0.04
R6020:Mdc1 UTSW 17 35857572 missense probably benign 0.01
R6219:Mdc1 UTSW 17 35850674 missense probably benign 0.10
R7053:Mdc1 UTSW 17 35846326 missense probably benign 0.00
R7073:Mdc1 UTSW 17 35854068 missense probably benign 0.18
R7077:Mdc1 UTSW 17 35845947 missense probably damaging 0.97
R7424:Mdc1 UTSW 17 35853309 missense probably benign 0.04
R7443:Mdc1 UTSW 17 35850820 missense probably damaging 0.98
R7467:Mdc1 UTSW 17 35844556 missense probably benign 0.29
R7549:Mdc1 UTSW 17 35848857 missense probably null 0.04
R7655:Mdc1 UTSW 17 35850881 missense probably benign 0.01
R7656:Mdc1 UTSW 17 35850881 missense probably benign 0.01
X0022:Mdc1 UTSW 17 35850937 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGATGCTTTTCAGCCTCAAGAG -3'
(R):5'- TACAGCCAGTTCAGGGACAG -3'

Sequencing Primer
(F):5'- TTTCAGCCTCAAGAGACTGC -3'
(R):5'- TTCAGGGACAGGATGGGAATTCC -3'
Posted On2019-12-04