Incidental Mutation 'RF025:Morn4'
Institutional Source Beutler Lab
Gene Symbol Morn4
Ensembl Gene ENSMUSG00000049670
Gene NameMORN repeat containing 4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.218) question?
Stock #RF025 (G1)
Quality Score214.459
Status Not validated
Chromosomal Location42074939-42086370 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) GCAG to GCAGGGAGTCAGTCAG at 42076111 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000062887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051772]
Predicted Effect probably null
Transcript: ENSMUST00000051772
SMART Domains Protein: ENSMUSP00000062887
Gene: ENSMUSG00000049670

MORN 14 35 1.64e-5 SMART
MORN 37 58 4.15e-2 SMART
MORN 60 81 1.86e-4 SMART
MORN 83 104 1.84e0 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 CTGCTG CTGCTGCATCCTGGGTTGCTG 4: 155,905,102 probably benign Het
AI837181 GGC GGCCGC 19: 5,425,226 probably benign Het
Arid1b GCG GCGTCG 17: 4,995,588 probably benign Het
Arid1b GGC GGCTGC 17: 4,995,596 probably benign Het
AY358078 CAGGT CAGGTAGGATAAGGT 14: 51,805,589 probably null Het
AY761185 GCACTGTGGGC G 8: 20,943,902 probably null Het
Bcar1 C A 8: 111,714,177 R395L possibly damaging Het
Begain CGCCGC CGCCGCGGCCGC 12: 109,033,424 probably benign Het
Cacna1f GAG GAGTAG X: 7,620,057 probably null Het
Calhm1 GC GCTGTGGCTGTGTC 19: 47,141,276 probably benign Het
Calhm1 C CTGTGAATGTGGA 19: 47,141,277 probably benign Het
Ccdc170 ACC ACCCCC 10: 4,561,026 probably benign Het
Cyb5r4 AGGGA AGGGATGTGACAGTCACACTGCCCTGGGA 9: 87,040,444 probably benign Het
Defb22 GCTGGCCT GCTGGCCTCTGCGGCAGACCTGGCCT 2: 152,485,823 probably benign Het
Defb22 CTGGC CTGGCGTTTGCGGCAGAGATGGC 2: 152,485,824 probably benign Het
Dock4 GTGCCGGTGCCGGT G 12: 40,844,393 probably null Het
Efhd2 CCGCC CCGCCGACGCC 4: 141,874,771 probably benign Het
Epha8 CCTGGGC CC 4: 136,933,037 probably benign Het
Eps8 CTCA CTCAATCA 6: 137,517,066 probably benign Het
Exd2 CAGCCAGAGC CAGC 12: 80,475,955 probably benign Het
Gab3 TCT TCTGCT X: 75,000,008 probably benign Het
Gm5475 GAAGGAAAGGT G 15: 100,427,152 probably null Het
Gm8369 TGTG TGTGCGTG 19: 11,511,773 probably null Het
Gpatch3 GGAG GG 4: 133,578,310 probably null Het
Heatr3 TTAT TTATGTAT 8: 88,156,456 probably benign Het
Igf1r GATGGAGC GATGGAGCTGGATATGGAGC 7: 68,226,179 probably benign Het
Las1l CTTCCT CTTCCTATTCCT X: 95,940,620 probably null Het
Lcmt1 GGC GGCCGCGGGGCGC 7: 123,369,834 probably null Het
Mamld1 AGC AGCCGC X: 71,118,826 probably benign Het
Map1a AGC AGCGCCAGCTCCAGCTCCAGCTCCAGCTCCCGC 2: 121,306,294 probably benign Het
Mdc1 CCCCCCCC CCCCCCCCCCCCCC 17: 35,854,407 probably benign Het
Mn1 CAG CAGTAG 5: 111,419,705 probably null Het
Nefh GGG GGGTACTTGTCCTCACCTTGG 11: 4,941,029 probably benign Het
Padi3 TCTCAC TC 4: 140,792,972 probably benign Het
Pdik1l CCC CCCCACC 4: 134,286,594 probably null Het
Plekhs1 TCCAGAC TCCAGACCTCCCCCCAGAC 19: 56,479,858 probably benign Het
Rtbdn GCGGC GCGGCAACGGC 8: 84,956,175 probably benign Het
Sh3pxd2b TGTGCCTGT TGTGCCTGTGCCTGT 11: 32,423,057 probably benign Het
Tfeb GCAACA GCAACAACA 17: 47,786,088 probably benign Het
Zfp106 CTCCTGGCAGT CT 2: 120,524,545 probably benign Het
Other mutations in Morn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Morn4 APN 19 42076120 missense possibly damaging 0.53
IGL02572:Morn4 APN 19 42076447 splice site probably benign
IGL02933:Morn4 APN 19 42076222 missense probably benign 0.01
FR4449:Morn4 UTSW 19 42076109 small insertion probably benign
FR4548:Morn4 UTSW 19 42076109 small insertion probably benign
R1997:Morn4 UTSW 19 42076538 missense possibly damaging 0.71
R2239:Morn4 UTSW 19 42078032 missense possibly damaging 0.93
R4409:Morn4 UTSW 19 42078547 missense possibly damaging 0.53
R5544:Morn4 UTSW 19 42076247 missense possibly damaging 0.71
R5695:Morn4 UTSW 19 42076117 missense possibly damaging 0.96
R6986:Morn4 UTSW 19 42078014 missense possibly damaging 0.71
R7024:Morn4 UTSW 19 42078044 missense possibly damaging 0.92
RF030:Morn4 UTSW 19 42076111 nonsense probably null
RF036:Morn4 UTSW 19 42076114 nonsense probably null
RF040:Morn4 UTSW 19 42076111 nonsense probably null
RF042:Morn4 UTSW 19 42076111 nonsense probably null
RF044:Morn4 UTSW 19 42076114 nonsense probably null
RF057:Morn4 UTSW 19 42076106 nonsense probably null
X0063:Morn4 UTSW 19 42077968 missense possibly damaging 0.71
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-12-04