Incidental Mutation 'RF025:Plekhs1'
ID604149
Institutional Source Beutler Lab
Gene Symbol Plekhs1
Ensembl Gene ENSMUSG00000035818
Gene Namepleckstrin homology domain containing, family S member 1
Synonyms9930023K05Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #RF025 (G1)
Quality Score214.458
Status Not validated
Chromosome19
Chromosomal Location56461640-56486752 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) TCCAGAC to TCCAGACCTCCCCCCAGAC at 56479858 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039666] [ENSMUST00000178590] [ENSMUST00000225909]
Predicted Effect probably benign
Transcript: ENSMUST00000039666
SMART Domains Protein: ENSMUSP00000035440
Gene: ENSMUSG00000035818

DomainStartEndE-ValueType
PH 21 137 4.68e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178590
SMART Domains Protein: ENSMUSP00000136674
Gene: ENSMUSG00000035818

DomainStartEndE-ValueType
PH 21 136 1.77e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224840
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225008
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225391
Predicted Effect probably benign
Transcript: ENSMUST00000225909
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 CTGCTG CTGCTGCATCCTGGGTTGCTG 4: 155,905,102 probably benign Het
AI837181 GGC GGCCGC 19: 5,425,226 probably benign Het
Arid1b GCG GCGTCG 17: 4,995,588 probably benign Het
Arid1b GGC GGCTGC 17: 4,995,596 probably benign Het
AY358078 CAGGT CAGGTAGGATAAGGT 14: 51,805,589 probably null Het
AY761185 GCACTGTGGGC G 8: 20,943,902 probably null Het
Bcar1 C A 8: 111,714,177 R395L possibly damaging Het
Begain CGCCGC CGCCGCGGCCGC 12: 109,033,424 probably benign Het
Cacna1f GAG GAGTAG X: 7,620,057 probably null Het
Calhm1 GC GCTGTGGCTGTGTC 19: 47,141,276 probably benign Het
Calhm1 C CTGTGAATGTGGA 19: 47,141,277 probably benign Het
Ccdc170 ACC ACCCCC 10: 4,561,026 probably benign Het
Cyb5r4 AGGGA AGGGATGTGACAGTCACACTGCCCTGGGA 9: 87,040,444 probably benign Het
Defb22 GCTGGCCT GCTGGCCTCTGCGGCAGACCTGGCCT 2: 152,485,823 probably benign Het
Defb22 CTGGC CTGGCGTTTGCGGCAGAGATGGC 2: 152,485,824 probably benign Het
Dnmt1 GGGCGGAGCACAGTTCCTACCTCGTT GGGCGGAGCACAGTTCCTACCTCGTTTTGGCGGCGGAGCACAGTTCCTACCTCGTT 9: 20,910,120 probably null Het
Dnmt1 CCTACCTCGTT CCTACCTCGTTTTGGGGGCGGAGAACAGTTTCTACCTCGTT 9: 20,910,135 probably null Het
Dock4 GTGCCGGTGCCGGT G 12: 40,844,393 probably null Het
Efhd2 CCGCC CCGCCGACGCC 4: 141,874,771 probably benign Het
Epha8 CCTGGGC CC 4: 136,933,037 probably benign Het
Eps8 CTCA CTCAATCA 6: 137,517,066 probably benign Het
Exd2 CAGCCAGAGC CAGC 12: 80,475,955 probably benign Het
Gab3 TCT TCTGCT X: 75,000,008 probably benign Het
Gm5475 GAAGGAAAGGT G 15: 100,427,152 probably null Het
Gm8369 TGTG TGTGCGTG 19: 11,511,773 probably null Het
Gm9573 CGGGGTAGGTGTAGATCCTGAGGCAGTGCTGGATGCAGGGGTGGTTGGGGTGGGTGTAGATCCTGAGGCAGTGCTGGATGCAG CGGGGTGGGTGTAGATCCTGAGGCAGTGCTGGATGCAG 17: 35,622,879 probably benign Het
Gpatch3 GGAG GG 4: 133,578,310 probably null Het
Heatr3 TTAT TTATGTAT 8: 88,156,456 probably benign Het
Hsdl2 GCAGGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGC GCAGGAGCAGCCACAGCTGCAGGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGC 4: 59,610,637 probably benign Het
Igf1r GATGGAGC GATGGAGCTGGATATGGAGC 7: 68,226,179 probably benign Het
Krtap28-10 AGCCACAGCCACCACAGCCACAGCCACCAC AGCCACAGCCACCACCGCCACAGCCACCACAGCCACAGCCACCAC 1: 83,042,258 probably benign Het
Las1l CTTCCT CTTCCTATTCCT X: 95,940,620 probably null Het
Lcmt1 GGC GGCCGCGGGGCGC 7: 123,369,834 probably null Het
Mamld1 AGC AGCCGC X: 71,118,826 probably benign Het
Map1a AGC AGCGCCAGCTCCAGCTCCAGCTCCAGCTCCCGC 2: 121,306,294 probably benign Het
Mdc1 CCCCCCCC CCCCCCCCCCCCCC 17: 35,854,407 probably benign Het
Mn1 CAG CAGTAG 5: 111,419,705 probably null Het
Morn4 GCAG GCAGGGAGTCAGTCAG 19: 42,076,111 probably null Het
Nefh CCTCAGCTGGGGACTTGG CCTCAGCTGGGGACTTGGGCTCAGCTGGGGACTTGG 11: 4,941,003 probably benign Het
Nefh GGG GGGTACTTGTCCTCACCTTGG 11: 4,941,029 probably benign Het
Padi3 TCTCAC TC 4: 140,792,972 probably benign Het
Pdik1l CCC CCCCACC 4: 134,286,594 probably null Het
Rtbdn GCGGC GCGGCAACGGC 8: 84,956,175 probably benign Het
Sh3pxd2b TGTGCCTGT TGTGCCTGTGCCTGT 11: 32,423,057 probably benign Het
Slamf6 GAGTATTATTCTTTTGTTTGTTTGTTTGTTTGTTTGTTTACAG GAG 1: 171,941,582 probably benign Het
Tfeb GCAACA GCAACAACA 17: 47,786,088 probably benign Het
Zfp106 CTCCTGGCAGT CT 2: 120,524,545 probably benign Het
Znrd1as CACCACCACCACCACCACCAC CACCACCACCACCACCACCACAACCACCACCACCACCACCAC 17: 36,965,048 probably benign Het
Other mutations in Plekhs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Plekhs1 APN 19 56464599 critical splice donor site probably null
IGL01387:Plekhs1 APN 19 56470971 missense probably benign 0.00
IGL02506:Plekhs1 APN 19 56471766 missense probably damaging 1.00
FR4304:Plekhs1 UTSW 19 56479858 unclassified probably benign
FR4340:Plekhs1 UTSW 19 56479858 unclassified probably benign
FR4342:Plekhs1 UTSW 19 56479858 unclassified probably benign
FR4342:Plekhs1 UTSW 19 56479861 unclassified probably benign
FR4589:Plekhs1 UTSW 19 56479863 unclassified probably benign
FR4737:Plekhs1 UTSW 19 56479863 unclassified probably benign
IGL03052:Plekhs1 UTSW 19 56470757 missense probably benign 0.43
R0023:Plekhs1 UTSW 19 56478516 missense probably damaging 0.99
R0023:Plekhs1 UTSW 19 56478516 missense probably damaging 0.99
R0100:Plekhs1 UTSW 19 56478502 missense probably damaging 1.00
R0100:Plekhs1 UTSW 19 56478502 missense probably damaging 1.00
R0129:Plekhs1 UTSW 19 56477290 critical splice donor site probably null
R0498:Plekhs1 UTSW 19 56481104 unclassified probably null
R1264:Plekhs1 UTSW 19 56485763 missense probably benign
R1528:Plekhs1 UTSW 19 56479995 missense probably damaging 1.00
R1650:Plekhs1 UTSW 19 56471042 missense probably damaging 1.00
R1820:Plekhs1 UTSW 19 56478522 missense possibly damaging 0.48
R2884:Plekhs1 UTSW 19 56470826 missense probably benign 0.01
R3237:Plekhs1 UTSW 19 56464600 splice site probably null
R4395:Plekhs1 UTSW 19 56479894 missense probably benign
R4825:Plekhs1 UTSW 19 56473268 splice site probably null
R5484:Plekhs1 UTSW 19 56479828 missense possibly damaging 0.82
R5511:Plekhs1 UTSW 19 56485792 missense probably damaging 0.97
R7105:Plekhs1 UTSW 19 56477215 missense probably damaging 0.99
R7267:Plekhs1 UTSW 19 56470777 missense probably damaging 0.96
R8212:Plekhs1 UTSW 19 56471756 missense probably damaging 1.00
RF043:Plekhs1 UTSW 19 56479858 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGCACAGACTTCGGGACTTTG -3'
(R):5'- GTTTAATGTGTCTGCCTCGC -3'

Sequencing Primer
(F):5'- GTTAGTCCCTCATATGGCTGTTAATG -3'
(R):5'- GCTCTTAGGGCCCACAAAGTTTTAG -3'
Posted On2019-12-04