Incidental Mutation 'RF025:Gab3'
ID604152
Institutional Source Beutler Lab
Gene Symbol Gab3
Ensembl Gene ENSMUSG00000032750
Gene Namegrowth factor receptor bound protein 2-associated protein 3
Synonyms5930433H21Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF025 (G1)
Quality Score151.467
Status Not validated
ChromosomeX
Chromosomal Location74966843-75085458 bp(-) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) TCT to TCTGCT at 75000008 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037374] [ENSMUST00000114104] [ENSMUST00000114109]
Predicted Effect probably benign
Transcript: ENSMUST00000037374
SMART Domains Protein: ENSMUSP00000041951
Gene: ENSMUSG00000032750

DomainStartEndE-ValueType
PH 6 119 3.2e-21 SMART
low complexity region 269 280 N/A INTRINSIC
low complexity region 307 314 N/A INTRINSIC
low complexity region 424 435 N/A INTRINSIC
coiled coil region 494 520 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114104
SMART Domains Protein: ENSMUSP00000109739
Gene: ENSMUSG00000032750

DomainStartEndE-ValueType
PH 6 119 3.2e-21 SMART
low complexity region 269 280 N/A INTRINSIC
low complexity region 307 314 N/A INTRINSIC
low complexity region 424 435 N/A INTRINSIC
coiled coil region 495 527 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114109
SMART Domains Protein: ENSMUSP00000109744
Gene: ENSMUSG00000032750

DomainStartEndE-ValueType
low complexity region 27 38 N/A INTRINSIC
coiled coil region 97 123 N/A INTRINSIC
Pfam:Pcc1 170 228 1.1e-9 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the GRB2-associated binding protein gene family. These proteins are scaffolding/docking proteins that are involved in several growth factor and cytokine signaling pathways, and they contain a pleckstrin homology domain, and bind SHP2 tyrosine phosphatase and GRB2 adapter protein. The protein encoded by this gene facilitates macrophage differentiation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Females homozygous and males hemizygous for disruptions in this X-linked gene developed normally, exhibted normal hematopoiesis, and were immunocompetent. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 CTGCTG CTGCTGCATCCTGGGTTGCTG 4: 155,905,102 probably benign Het
AI837181 GGC GGCCGC 19: 5,425,226 probably benign Het
Arid1b GCG GCGTCG 17: 4,995,588 probably benign Het
Arid1b GGC GGCTGC 17: 4,995,596 probably benign Het
AY358078 CAGGT CAGGTAGGATAAGGT 14: 51,805,589 probably null Het
AY761185 GCACTGTGGGC G 8: 20,943,902 probably null Het
Bcar1 C A 8: 111,714,177 R395L possibly damaging Het
Begain CGCCGC CGCCGCGGCCGC 12: 109,033,424 probably benign Het
Cacna1f GAG GAGTAG X: 7,620,057 probably null Het
Calhm1 GC GCTGTGGCTGTGTC 19: 47,141,276 probably benign Het
Calhm1 C CTGTGAATGTGGA 19: 47,141,277 probably benign Het
Ccdc170 ACC ACCCCC 10: 4,561,026 probably benign Het
Cyb5r4 AGGGA AGGGATGTGACAGTCACACTGCCCTGGGA 9: 87,040,444 probably benign Het
Defb22 GCTGGCCT GCTGGCCTCTGCGGCAGACCTGGCCT 2: 152,485,823 probably benign Het
Defb22 CTGGC CTGGCGTTTGCGGCAGAGATGGC 2: 152,485,824 probably benign Het
Dnmt1 GGGCGGAGCACAGTTCCTACCTCGTT GGGCGGAGCACAGTTCCTACCTCGTTTTGGCGGCGGAGCACAGTTCCTACCTCGTT 9: 20,910,120 probably null Het
Dnmt1 CCTACCTCGTT CCTACCTCGTTTTGGGGGCGGAGAACAGTTTCTACCTCGTT 9: 20,910,135 probably null Het
Dock4 GTGCCGGTGCCGGT G 12: 40,844,393 probably null Het
Efhd2 CCGCC CCGCCGACGCC 4: 141,874,771 probably benign Het
Epha8 CCTGGGC CC 4: 136,933,037 probably benign Het
Eps8 CTCA CTCAATCA 6: 137,517,066 probably benign Het
Exd2 CAGCCAGAGC CAGC 12: 80,475,955 probably benign Het
Gm5475 GAAGGAAAGGT G 15: 100,427,152 probably null Het
Gm8369 TGTG TGTGCGTG 19: 11,511,773 probably null Het
Gm9573 CGGGGTAGGTGTAGATCCTGAGGCAGTGCTGGATGCAGGGGTGGTTGGGGTGGGTGTAGATCCTGAGGCAGTGCTGGATGCAG CGGGGTGGGTGTAGATCCTGAGGCAGTGCTGGATGCAG 17: 35,622,879 probably benign Het
Gpatch3 GGAG GG 4: 133,578,310 probably null Het
Heatr3 TTAT TTATGTAT 8: 88,156,456 probably benign Het
Hsdl2 GCAGGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGC GCAGGAGCAGCCACAGCTGCAGGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGC 4: 59,610,637 probably benign Het
Igf1r GATGGAGC GATGGAGCTGGATATGGAGC 7: 68,226,179 probably benign Het
Krtap28-10 AGCCACAGCCACCACAGCCACAGCCACCAC AGCCACAGCCACCACCGCCACAGCCACCACAGCCACAGCCACCAC 1: 83,042,258 probably benign Het
Las1l CTTCCT CTTCCTATTCCT X: 95,940,620 probably null Het
Lcmt1 GGC GGCCGCGGGGCGC 7: 123,369,834 probably null Het
Mamld1 AGC AGCCGC X: 71,118,826 probably benign Het
Map1a AGC AGCGCCAGCTCCAGCTCCAGCTCCAGCTCCCGC 2: 121,306,294 probably benign Het
Mdc1 CCCCCCCC CCCCCCCCCCCCCC 17: 35,854,407 probably benign Het
Mn1 CAG CAGTAG 5: 111,419,705 probably null Het
Morn4 GCAG GCAGGGAGTCAGTCAG 19: 42,076,111 probably null Het
Nefh CCTCAGCTGGGGACTTGG CCTCAGCTGGGGACTTGGGCTCAGCTGGGGACTTGG 11: 4,941,003 probably benign Het
Nefh GGG GGGTACTTGTCCTCACCTTGG 11: 4,941,029 probably benign Het
Padi3 TCTCAC TC 4: 140,792,972 probably benign Het
Pdik1l CCC CCCCACC 4: 134,286,594 probably null Het
Plekhs1 TCCAGAC TCCAGACCTCCCCCCAGAC 19: 56,479,858 probably benign Het
Rtbdn GCGGC GCGGCAACGGC 8: 84,956,175 probably benign Het
Sh3pxd2b TGTGCCTGT TGTGCCTGTGCCTGT 11: 32,423,057 probably benign Het
Slamf6 GAGTATTATTCTTTTGTTTGTTTGTTTGTTTGTTTGTTTACAG GAG 1: 171,941,582 probably benign Het
Tfeb GCAACA GCAACAACA 17: 47,786,088 probably benign Het
Zfp106 CTCCTGGCAGT CT 2: 120,524,545 probably benign Het
Znrd1as CACCACCACCACCACCACCAC CACCACCACCACCACCACCACAACCACCACCACCACCACCAC 17: 36,965,048 probably benign Het
Other mutations in Gab3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00706:Gab3 APN X 75005359 missense probably benign 0.00
R0894:Gab3 UTSW X 75033418 missense probably damaging 1.00
R2069:Gab3 UTSW X 75000095 missense probably damaging 1.00
R2102:Gab3 UTSW X 74999979 small insertion probably benign
RF001:Gab3 UTSW X 75000018 small insertion probably benign
RF003:Gab3 UTSW X 75000006 nonsense probably null
RF006:Gab3 UTSW X 75000027 small insertion probably benign
RF007:Gab3 UTSW X 74999996 small insertion probably benign
RF007:Gab3 UTSW X 75000011 small insertion probably benign
RF007:Gab3 UTSW X 75000025 small insertion probably benign
RF009:Gab3 UTSW X 74999992 small insertion probably benign
RF009:Gab3 UTSW X 75000024 nonsense probably null
RF010:Gab3 UTSW X 75000011 small insertion probably benign
RF012:Gab3 UTSW X 75000020 small insertion probably benign
RF016:Gab3 UTSW X 74999985 nonsense probably null
RF020:Gab3 UTSW X 75000017 small insertion probably benign
RF022:Gab3 UTSW X 74999994 nonsense probably null
RF026:Gab3 UTSW X 74999990 small insertion probably benign
RF026:Gab3 UTSW X 75000023 small insertion probably benign
RF028:Gab3 UTSW X 75000000 nonsense probably null
RF028:Gab3 UTSW X 75000017 small insertion probably benign
RF030:Gab3 UTSW X 74999977 small deletion probably benign
RF030:Gab3 UTSW X 75000005 small insertion probably benign
RF030:Gab3 UTSW X 75000008 small insertion probably benign
RF030:Gab3 UTSW X 75000025 small insertion probably benign
RF030:Gab3 UTSW X 75000026 small insertion probably benign
RF031:Gab3 UTSW X 74999996 small insertion probably benign
RF031:Gab3 UTSW X 74999997 nonsense probably null
RF031:Gab3 UTSW X 75000001 small insertion probably benign
RF033:Gab3 UTSW X 75000001 small insertion probably benign
RF033:Gab3 UTSW X 75000023 small insertion probably benign
RF039:Gab3 UTSW X 75000004 small insertion probably benign
RF040:Gab3 UTSW X 75000027 small insertion probably benign
RF042:Gab3 UTSW X 75000005 small insertion probably benign
RF042:Gab3 UTSW X 75000022 small insertion probably benign
RF044:Gab3 UTSW X 75000005 small insertion probably benign
RF047:Gab3 UTSW X 74999993 small insertion probably benign
RF052:Gab3 UTSW X 74999983 small insertion probably benign
RF055:Gab3 UTSW X 74999987 small insertion probably benign
RF055:Gab3 UTSW X 75000010 small insertion probably benign
RF058:Gab3 UTSW X 75000002 small insertion probably benign
RF059:Gab3 UTSW X 74999990 small insertion probably benign
RF060:Gab3 UTSW X 75000013 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- CCGGTGACCTGGTTTTATAATAAGC -3'
(R):5'- TTGGAAGGAACAGGCTCAAACC -3'

Sequencing Primer
(F):5'- AAGCCATTCTTTATGACTGCACAC -3'
(R):5'- CCCACAGGGCTGTCTGTTC -3'
Posted On2019-12-04