Incidental Mutation 'RF026:Lce1m'
ID 604159
Institutional Source Beutler Lab
Gene Symbol Lce1m
Ensembl Gene ENSMUSG00000027912
Gene Name late cornified envelope 1M
Synonyms Sprrl10, Lce5a, 1110059L13Rik
Accession Numbers
Is this an essential gene? Not available question?
Stock # RF026 (G1)
Quality Score 217.468
Status Not validated
Chromosome 3
Chromosomal Location 93017810-93019060 bp(-) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) CCACTGCTGCT to CCACTGCTGCTTTCACTGCTGCT at 93018138 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029520] [ENSMUST00000029521] [ENSMUST00000107301] [ENSMUST00000193944]
AlphaFold Q9CR91
Predicted Effect probably benign
Transcript: ENSMUST00000029520
SMART Domains Protein: ENSMUSP00000029520
Gene: ENSMUSG00000027912

DomainStartEndE-ValueType
Pfam:LCE 9 96 5.4e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000029521
SMART Domains Protein: ENSMUSP00000029521
Gene: ENSMUSG00000027913

DomainStartEndE-ValueType
low complexity region 12 102 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107301
SMART Domains Protein: ENSMUSP00000102922
Gene: ENSMUSG00000027913

DomainStartEndE-ValueType
Pfam:NICE-1 5 100 5.4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193944
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI837181 GCG GCGTCG 19: 5,425,224 probably benign Het
Ankhd1 GGCGGC GGCGGCTGCGGC 18: 36,560,912 probably benign Het
Cacna1f GA GAGTA X: 7,620,075 probably null Het
Cox7a2l GGA GGATGGGGA 17: 83,502,722 probably benign Het
Cul9 CCT CCTACT 17: 46,500,869 probably null Het
Cyb5r4 ACACACTGCC ACACACTGCCTAGGGATGTGACAGCCACACTGCC 9: 87,040,433 probably benign Het
Foxd3 GGACCCTACGGCCG GG 4: 99,657,396 probably benign Het
Gab3 TCT TCTGCT X: 74,999,990 probably benign Het
Gab3 TCT TCTGCT X: 75,000,023 probably benign Het
Hsdl2 GCAG GCAGCAGCAGCCACAGCTACAG 4: 59,610,655 probably benign Het
Kmt2e TTT TTTTGTT 5: 23,478,509 probably benign Het
Krtap28-10 CACAGC CACAGCAACAGC 1: 83,042,126 probably benign Het
Mrgprx1 GAAC GAACAAC 7: 48,021,509 probably benign Het
Nusap1 GCAGTGAGGAGCAAGCTGAGA GCAGTGAGGAGCAAGCTGAGATACACGTTATCAGTGAGGAGCAAGCTGAGA 2: 119,627,590 probably benign Het
Nusap1 GCTG GCTGGGATACACGTTAGCAGTGAGGAGCAATCTG 2: 119,627,604 probably benign Het
Pdik1l CCCA CCCACCA 4: 134,286,594 probably benign Het
Rbm33 CCAGCCGCAGC CCAGC 5: 28,394,181 probably benign Het
Supt20 T TACAGCA 3: 54,727,647 probably benign Het
Supt20 CA CAGCAGTA 3: 54,727,670 probably null Het
Trav15-2-dv6-2 G GAAT 14: 53,649,757 probably benign Het
Yipf3 AGAGGA AGA 17: 46,248,972 probably benign Het
Zfp384 CAGGC CAGGCCCATGCCAAGGC 6: 125,036,492 probably benign Het
Other mutations in Lce1m
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4342:Lce1m UTSW 3 93018247 unclassified probably benign
FR4449:Lce1m UTSW 3 93018152 unclassified probably benign
FR4589:Lce1m UTSW 3 93018268 unclassified probably benign
FR4976:Lce1m UTSW 3 93018148 unclassified probably benign
R1513:Lce1m UTSW 3 93018625 unclassified probably benign
R7621:Lce1m UTSW 3 93017870 splice site probably null
R7753:Lce1m UTSW 3 93018508 missense unknown
RF001:Lce1m UTSW 3 93018152 unclassified probably benign
RF001:Lce1m UTSW 3 93018269 unclassified probably benign
RF002:Lce1m UTSW 3 93018283 unclassified probably benign
RF002:Lce1m UTSW 3 93018299 unclassified probably benign
RF007:Lce1m UTSW 3 93018144 unclassified probably benign
RF009:Lce1m UTSW 3 93018131 unclassified probably benign
RF010:Lce1m UTSW 3 93018290 unclassified probably benign
RF015:Lce1m UTSW 3 93018148 unclassified probably benign
RF021:Lce1m UTSW 3 93018269 unclassified probably benign
RF021:Lce1m UTSW 3 93018295 unclassified probably benign
RF023:Lce1m UTSW 3 93018280 unclassified probably benign
RF026:Lce1m UTSW 3 93018143 unclassified probably benign
RF028:Lce1m UTSW 3 93018131 unclassified probably benign
RF030:Lce1m UTSW 3 93018141 unclassified probably benign
RF030:Lce1m UTSW 3 93018344 unclassified probably benign
RF037:Lce1m UTSW 3 93018300 unclassified probably benign
RF041:Lce1m UTSW 3 93018141 unclassified probably benign
RF042:Lce1m UTSW 3 93018139 unclassified probably benign
RF045:Lce1m UTSW 3 93018292 unclassified probably benign
RF046:Lce1m UTSW 3 93018293 unclassified probably benign
RF054:Lce1m UTSW 3 93018298 unclassified probably benign
RF059:Lce1m UTSW 3 93018329 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ACCTCGTGGTAGATGAGCTTTAGG -3'
(R):5'- ACAGCTCTGGATGCTGTAGC -3'

Sequencing Primer
(F):5'- CTTTAGGGAGATGAAGAGGACGTAC -3'
(R):5'- TGTAGCAGCGGTGGCAG -3'
Posted On 2019-12-04