Incidental Mutation 'RF026:Lce1m'
Institutional Source Beutler Lab
Gene Symbol Lce1m
Ensembl Gene ENSMUSG00000027912
Gene Namelate cornified envelope 1M
SynonymsSprrl10, Lce5a, 1110059L13Rik
Accession Numbers
Is this an essential gene? Not available question?
Stock #RF026 (G1)
Quality Score217.468
Status Not validated
Chromosomal Location93017810-93019060 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) CCACTGCTGCT to CCACTGCTGCTTTCACTGCTGCT at 93018138 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029520] [ENSMUST00000029521] [ENSMUST00000107301] [ENSMUST00000193944]
Predicted Effect probably benign
Transcript: ENSMUST00000029520
SMART Domains Protein: ENSMUSP00000029520
Gene: ENSMUSG00000027912

Pfam:LCE 9 96 5.4e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000029521
SMART Domains Protein: ENSMUSP00000029521
Gene: ENSMUSG00000027913

low complexity region 12 102 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107301
SMART Domains Protein: ENSMUSP00000102922
Gene: ENSMUSG00000027913

Pfam:NICE-1 5 100 5.4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193944
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI837181 GCG GCGTCG 19: 5,425,224 probably benign Het
Ankhd1 GGCGGC GGCGGCTGCGGC 18: 36,560,912 probably benign Het
Cacna1f GA GAGTA X: 7,620,075 probably null Het
Cox7a2l GGA GGATGGGGA 17: 83,502,722 probably benign Het
Cul9 CCT CCTACT 17: 46,500,869 probably null Het
Foxd3 GGACCCTACGGCCG GG 4: 99,657,396 probably benign Het
Gab3 TCT TCTGCT X: 74,999,990 probably benign Het
Gab3 TCT TCTGCT X: 75,000,023 probably benign Het
Hsdl2 GCAG GCAGCAGCAGCCACAGCTACAG 4: 59,610,655 probably benign Het
Kmt2e TTT TTTTGTT 5: 23,478,509 probably benign Het
Krtap28-10 CACAGC CACAGCAACAGC 1: 83,042,126 probably benign Het
Mrgprx1 GAAC GAACAAC 7: 48,021,509 probably benign Het
Nusap1 GCTG GCTGGGATACACGTTAGCAGTGAGGAGCAATCTG 2: 119,627,604 probably benign Het
Pdik1l CCCA CCCACCA 4: 134,286,594 probably benign Het
Rbm33 CCAGCCGCAGC CCAGC 5: 28,394,181 probably benign Het
Supt20 T TACAGCA 3: 54,727,647 probably benign Het
Supt20 CA CAGCAGTA 3: 54,727,670 probably null Het
Trav15-2-dv6-2 G GAAT 14: 53,649,757 probably benign Het
Yipf3 AGAGGA AGA 17: 46,248,972 probably benign Het
Zfp384 CAGGC CAGGCCCATGCCAAGGC 6: 125,036,492 probably benign Het
Other mutations in Lce1m
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4342:Lce1m UTSW 3 93018247 unclassified probably benign
FR4449:Lce1m UTSW 3 93018152 unclassified probably benign
FR4589:Lce1m UTSW 3 93018268 unclassified probably benign
FR4976:Lce1m UTSW 3 93018148 unclassified probably benign
R1513:Lce1m UTSW 3 93018625 unclassified probably benign
R7621:Lce1m UTSW 3 93017870 splice site probably null
R7753:Lce1m UTSW 3 93018508 missense unknown
RF001:Lce1m UTSW 3 93018152 unclassified probably benign
RF001:Lce1m UTSW 3 93018269 unclassified probably benign
RF002:Lce1m UTSW 3 93018283 unclassified probably benign
RF002:Lce1m UTSW 3 93018299 unclassified probably benign
RF007:Lce1m UTSW 3 93018144 unclassified probably benign
RF009:Lce1m UTSW 3 93018131 unclassified probably benign
RF010:Lce1m UTSW 3 93018290 unclassified probably benign
RF015:Lce1m UTSW 3 93018148 unclassified probably benign
RF021:Lce1m UTSW 3 93018269 unclassified probably benign
RF021:Lce1m UTSW 3 93018295 unclassified probably benign
RF023:Lce1m UTSW 3 93018280 unclassified probably benign
RF026:Lce1m UTSW 3 93018143 unclassified probably benign
RF028:Lce1m UTSW 3 93018131 unclassified probably benign
RF030:Lce1m UTSW 3 93018141 unclassified probably benign
RF030:Lce1m UTSW 3 93018344 unclassified probably benign
RF037:Lce1m UTSW 3 93018300 unclassified probably benign
RF041:Lce1m UTSW 3 93018141 unclassified probably benign
RF042:Lce1m UTSW 3 93018139 unclassified probably benign
RF045:Lce1m UTSW 3 93018292 unclassified probably benign
RF046:Lce1m UTSW 3 93018293 unclassified probably benign
RF054:Lce1m UTSW 3 93018298 unclassified probably benign
RF059:Lce1m UTSW 3 93018329 unclassified probably benign
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-12-04