Incidental Mutation 'RF026:Mrgprx1'
ID604167
Institutional Source Beutler Lab
Gene Symbol Mrgprx1
Ensembl Gene ENSMUSG00000070552
Gene NameMAS-related GPR, member X1
SynonymsMrgprc11, MrgC11
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF026 (G1)
Quality Score163.492
Status Not validated
Chromosome7
Chromosomal Location48020971-48027597 bp(-) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) GAAC to GAACAAC at 48021509 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000091954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094390]
Predicted Effect probably benign
Transcript: ENSMUST00000094390
SMART Domains Protein: ENSMUSP00000091954
Gene: ENSMUSG00000070552

DomainStartEndE-ValueType
Pfam:7tm_1 43 202 1.9e-7 PFAM
low complexity region 227 245 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI837181 GCG GCGTCG 19: 5,425,224 probably benign Het
Ankhd1 GGCGGC GGCGGCTGCGGC 18: 36,560,912 probably benign Het
Cacna1f GA GAGTA X: 7,620,075 probably null Het
Cox7a2l GGA GGATGGGGA 17: 83,502,722 probably benign Het
Cul9 CCT CCTACT 17: 46,500,869 probably null Het
Cyb5r4 ACACACTGCC ACACACTGCCTAGGGATGTGACAGCCACACTGCC 9: 87,040,433 probably benign Het
Foxd3 GGACCCTACGGCCG GG 4: 99,657,396 probably benign Het
Gab3 TCT TCTGCT X: 74,999,990 probably benign Het
Gab3 TCT TCTGCT X: 75,000,023 probably benign Het
Hsdl2 GCAG GCAGCAGCAGCCACAGCTACAG 4: 59,610,655 probably benign Het
Kmt2e TTT TTTTGTT 5: 23,478,509 probably benign Het
Krtap28-10 CACAGC CACAGCAACAGC 1: 83,042,126 probably benign Het
Lce1m CCACTGCTGCT CCACTGCTGCTTTCACTGCTGCT 3: 93,018,138 probably benign Het
Lce1m GCTGCTGCCAC GCTGCTGCCACTTCTGCTGCCAC 3: 93,018,143 probably benign Het
Nusap1 GCAGTGAGGAGCAAGCTGAGA GCAGTGAGGAGCAAGCTGAGATACACGTTATCAGTGAGGAGCAAGCTGAGA 2: 119,627,590 probably benign Het
Nusap1 GCTG GCTGGGATACACGTTAGCAGTGAGGAGCAATCTG 2: 119,627,604 probably benign Het
Pdik1l CCCA CCCACCA 4: 134,286,594 probably benign Het
Rbm33 CCAGCCGCAGC CCAGC 5: 28,394,181 probably benign Het
Supt20 T TACAGCA 3: 54,727,647 probably benign Het
Supt20 CA CAGCAGTA 3: 54,727,670 probably null Het
Trav15-2-dv6-2 G GAAT 14: 53,649,757 probably benign Het
Yipf3 AGAGGA AGA 17: 46,248,972 probably benign Het
Zfp384 CAGGC CAGGCCCATGCCAAGGC 6: 125,036,492 probably benign Het
Other mutations in Mrgprx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Mrgprx1 APN 7 48021486 missense probably benign 0.00
IGL01326:Mrgprx1 APN 7 48021769 missense probably benign 0.26
IGL02117:Mrgprx1 APN 7 48021623 nonsense probably null
IGL02219:Mrgprx1 APN 7 48021729 missense probably benign 0.20
IGL02431:Mrgprx1 APN 7 48021127 missense probably benign 0.00
IGL02441:Mrgprx1 APN 7 48021588 missense probably benign 0.39
IGL02682:Mrgprx1 APN 7 48021992 missense probably damaging 1.00
R0219:Mrgprx1 UTSW 7 48021546 missense probably damaging 1.00
R4366:Mrgprx1 UTSW 7 48021193 missense probably damaging 0.98
R4521:Mrgprx1 UTSW 7 48021699 missense probably benign
R4801:Mrgprx1 UTSW 7 48021211 missense possibly damaging 0.89
R4802:Mrgprx1 UTSW 7 48021211 missense possibly damaging 0.89
R5452:Mrgprx1 UTSW 7 48021808 missense probably benign 0.07
R5537:Mrgprx1 UTSW 7 48021150 missense probably benign
R6444:Mrgprx1 UTSW 7 48021814 missense possibly damaging 0.87
R6834:Mrgprx1 UTSW 7 48021637 missense probably damaging 0.99
R7406:Mrgprx1 UTSW 7 48021985 missense possibly damaging 0.62
RF020:Mrgprx1 UTSW 7 48021511 small insertion probably benign
RF024:Mrgprx1 UTSW 7 48021511 small insertion probably benign
RF043:Mrgprx1 UTSW 7 48021509 small insertion probably benign
Z1088:Mrgprx1 UTSW 7 48021129 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CATCACTGTGAGAGCGATGG -3'
(R):5'- GCCTCTATGCCCATAAATTAAGC -3'

Sequencing Primer
(F):5'- TGGTAACATACAGCCTGGACAG -3'
(R):5'- TCTTAGGCAATGCAGCAATCATC -3'
Posted On2019-12-04