Incidental Mutation 'RF027:4930402H24Rik'
Institutional Source Beutler Lab
Gene Symbol 4930402H24Rik
Ensembl Gene ENSMUSG00000027309
Gene NameRIKEN cDNA 4930402H24 gene
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF027 (G1)
Quality Score191.468
Status Not validated
Chromosomal Location130706200-130906406 bp(-) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) CTC to CTCGTC at 130770744 bp
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000044766] [ENSMUST00000119422]
Predicted Effect probably benign
Transcript: ENSMUST00000044766
SMART Domains Protein: ENSMUSP00000046992
Gene: ENSMUSG00000027309

low complexity region 134 145 N/A INTRINSIC
low complexity region 463 473 N/A INTRINSIC
low complexity region 533 545 N/A INTRINSIC
coiled coil region 1143 1171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119422
SMART Domains Protein: ENSMUSP00000113481
Gene: ENSMUSG00000027309

low complexity region 3 14 N/A INTRINSIC
low complexity region 332 342 N/A INTRINSIC
low complexity region 402 414 N/A INTRINSIC
coiled coil region 1012 1040 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145851
SMART Domains Protein: ENSMUSP00000118946
Gene: ENSMUSG00000027309

low complexity region 6 16 N/A INTRINSIC
low complexity region 76 88 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an uncharacterized protein with a C-terminal coiled-coil region. The gene is located on chromosome 20p13 in a 1.8 Mb region linked to a spinocerebellar ataxia phenotype, but this gene does not appear to be a disease candidate. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1f GAG GAGTAG X: 7,620,054 probably null Het
Ccdc170 ACC ACCTCC 10: 4,561,026 probably benign Het
Cul9 CTTC CTTCTTC 17: 46,500,848 probably benign Het
Dnah8 CCCTCCCG C 17: 30,635,476 probably null Het
Fam171b AGCAGC AGCAGCTGCAGC 2: 83,812,876 probably benign Het
Ifi208 AGATG AG 1: 173,677,696 probably benign Het
Kri1 CTCCTCCT C 9: 21,281,068 probably null Het
Krtap28-10 CACAGC CACAGCCACAGCCACAACAGC 1: 83,042,285 probably benign Het
Lor ATAGCCG A 3: 92,081,876 probably benign Het
Lrmp TG TGAGCACATGG 6: 145,173,790 probably benign Het
Med12l AGC AGCGGC 3: 59,275,967 probably benign Het
Med12l CAG CAGAAG 3: 59,275,981 probably benign Het
Mn1 CAG CAGAAG 5: 111,419,705 probably benign Het
Mnd1 G A 3: 84,134,059 L79F possibly damaging Het
Nolc1 AGCAGCAGC AGCAGCAGCGGCAGCAGC 19: 46,081,363 probably benign Het
Papd7 GACA G 13: 69,533,854 probably benign Het
Pdcd11 GGAGGAG GG 19: 47,113,449 probably null Het
Rbfox2 G T 15: 77,132,773 Q134K possibly damaging Het
Tcof1 AGC AGCTGC 18: 60,835,736 probably benign Het
Ttf2 TTCT TTCTTCT 3: 100,963,157 probably benign Het
Ubtf CTTC CTTCTTC 11: 102,306,945 probably benign Het
Vmn2r58 CAAAATGATGTAGCACTT C 7: 41,836,959 probably null Het
Zfhx3 CAGCAGCA CAGCAGCAAGAGCAGCA 8: 108,956,098 probably benign Het
Zfp384 CCCAGGC CCCAGGCCCAGGACCAGGC 6: 125,036,490 probably benign Het
Other mutations in 4930402H24Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:4930402H24Rik APN 2 130784457 missense probably benign 0.00
IGL01093:4930402H24Rik APN 2 130777236 missense probably benign 0.01
IGL01111:4930402H24Rik APN 2 130736598 missense possibly damaging 0.66
IGL01146:4930402H24Rik APN 2 130770671 critical splice donor site probably null
IGL01346:4930402H24Rik APN 2 130791846 splice site probably benign
IGL01548:4930402H24Rik APN 2 130814259 missense probably damaging 1.00
IGL02339:4930402H24Rik APN 2 130739465 missense probably damaging 0.97
IGL02637:4930402H24Rik APN 2 130814307 intron probably benign
IGL02926:4930402H24Rik APN 2 130712366 missense probably benign 0.00
IGL02978:4930402H24Rik APN 2 130727162 missense probably damaging 0.99
IGL03126:4930402H24Rik APN 2 130791995 splice site probably null
IGL03387:4930402H24Rik APN 2 130717280 missense probably damaging 1.00
best_times UTSW 2 130736576 missense probably damaging 0.99
Hard_times UTSW 2 130713470 missense probably benign 0.16
worst_times UTSW 2 130713414 missense probably damaging 1.00
FR4304:4930402H24Rik UTSW 2 130770748 small insertion probably benign
FR4342:4930402H24Rik UTSW 2 130770742 small insertion probably benign
FR4589:4930402H24Rik UTSW 2 130770745 small insertion probably benign
FR4589:4930402H24Rik UTSW 2 130770752 small insertion probably benign
FR4737:4930402H24Rik UTSW 2 130770752 small insertion probably benign
FR4976:4930402H24Rik UTSW 2 130770739 small insertion probably benign
FR4976:4930402H24Rik UTSW 2 130770742 small insertion probably benign
FR4976:4930402H24Rik UTSW 2 130770753 small insertion probably benign
R0034:4930402H24Rik UTSW 2 130736572 missense probably damaging 1.00
R0034:4930402H24Rik UTSW 2 130736572 missense probably damaging 1.00
R0357:4930402H24Rik UTSW 2 130712946 splice site probably benign
R0379:4930402H24Rik UTSW 2 130785546 splice site probably benign
R0515:4930402H24Rik UTSW 2 130740488 missense probably damaging 1.00
R0576:4930402H24Rik UTSW 2 130713470 missense probably benign 0.16
R0811:4930402H24Rik UTSW 2 130713414 missense probably damaging 1.00
R0812:4930402H24Rik UTSW 2 130713414 missense probably damaging 1.00
R1334:4930402H24Rik UTSW 2 130775722 splice site probably null
R1485:4930402H24Rik UTSW 2 130748683 critical splice donor site probably null
R1486:4930402H24Rik UTSW 2 130737418 missense probably damaging 1.00
R1670:4930402H24Rik UTSW 2 130712379 missense probably damaging 1.00
R1678:4930402H24Rik UTSW 2 130814273 missense probably damaging 0.99
R1700:4930402H24Rik UTSW 2 130709938 missense probably damaging 0.99
R1742:4930402H24Rik UTSW 2 130740395 splice site probably null
R2046:4930402H24Rik UTSW 2 130810917 missense possibly damaging 0.61
R2374:4930402H24Rik UTSW 2 130820574 missense probably damaging 1.00
R3878:4930402H24Rik UTSW 2 130778503 missense possibly damaging 0.92
R3907:4930402H24Rik UTSW 2 130736576 missense probably damaging 0.99
R4467:4930402H24Rik UTSW 2 130767647 missense probably damaging 0.96
R4931:4930402H24Rik UTSW 2 130741873 missense possibly damaging 0.58
R5098:4930402H24Rik UTSW 2 130798181 missense probably damaging 0.99
R5191:4930402H24Rik UTSW 2 130737403 missense possibly damaging 0.68
R5313:4930402H24Rik UTSW 2 130709268 missense probably damaging 1.00
R5405:4930402H24Rik UTSW 2 130712460 missense probably damaging 1.00
R5436:4930402H24Rik UTSW 2 130764499 missense probably benign 0.16
R5522:4930402H24Rik UTSW 2 130814302 intron probably benign
R5783:4930402H24Rik UTSW 2 130739083 missense possibly damaging 0.59
R5931:4930402H24Rik UTSW 2 130814189 missense probably damaging 1.00
R6145:4930402H24Rik UTSW 2 130778473 missense probably benign
R6732:4930402H24Rik UTSW 2 130810820 critical splice donor site probably null
R6938:4930402H24Rik UTSW 2 130775753 missense probably benign 0.00
R7161:4930402H24Rik UTSW 2 130806788 missense unknown
R7193:4930402H24Rik UTSW 2 130806788 missense unknown
R7194:4930402H24Rik UTSW 2 130806788 missense unknown
R7233:4930402H24Rik UTSW 2 130806788 missense unknown
R7234:4930402H24Rik UTSW 2 130806788 missense unknown
R7238:4930402H24Rik UTSW 2 130806788 missense unknown
R7239:4930402H24Rik UTSW 2 130806788 missense unknown
R7268:4930402H24Rik UTSW 2 130806788 missense unknown
R7807:4930402H24Rik UTSW 2 130710865 missense probably damaging 1.00
R7904:4930402H24Rik UTSW 2 130792003 splice site probably null
R7999:4930402H24Rik UTSW 2 130737452 missense probably benign 0.00
R8047:4930402H24Rik UTSW 2 130775099 missense probably damaging 0.98
R8286:4930402H24Rik UTSW 2 130717328 missense probably damaging 1.00
R8315:4930402H24Rik UTSW 2 130770735 small deletion probably benign
R8439:4930402H24Rik UTSW 2 130770701 missense probably damaging 1.00
R8925:4930402H24Rik UTSW 2 130737380 nonsense probably null
R8927:4930402H24Rik UTSW 2 130737380 nonsense probably null
RF038:4930402H24Rik UTSW 2 130770744 nonsense probably null
RF046:4930402H24Rik UTSW 2 130770734 nonsense probably null
RF048:4930402H24Rik UTSW 2 130770734 nonsense probably null
Z1177:4930402H24Rik UTSW 2 130710867 missense probably benign 0.04
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-12-04