Incidental Mutation 'RF027:Lor'
ID 604185
Institutional Source Beutler Lab
Gene Symbol Lor
Ensembl Gene ENSMUSG00000043165
Gene Name loricrin
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock # RF027 (G1)
Quality Score 129.467
Status Not validated
Chromosome 3
Chromosomal Location 92080271-92083142 bp(-) (GRCm38)
Type of Mutation small deletion (2 aa in frame mutation)
DNA Base Change (assembly) ATAGCCG to A at 92081876 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000052128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058150]
AlphaFold P18165
Predicted Effect probably benign
Transcript: ENSMUST00000058150
SMART Domains Protein: ENSMUSP00000052128
Gene: ENSMUSG00000043165

Pfam:Loricrin 316 438 2.7e-11 PFAM
Pfam:Loricrin 426 486 1.4e-14 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene are runted at birth, have a translucent skin and skin skin barrier defect. The morphological skin phenotype disappears after 4-5 days. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik CTC CTCGTC 2: 130,770,744 probably benign Het
Cacna1f GAG GAGTAG X: 7,620,054 probably null Het
Ccdc170 ACC ACCTCC 10: 4,561,026 probably benign Het
Cul9 CTTC CTTCTTC 17: 46,500,848 probably benign Het
Dnah8 CCCTCCCG C 17: 30,635,476 probably null Het
Fam171b AGCAGC AGCAGCTGCAGC 2: 83,812,876 probably benign Het
Ifi208 AGATG AG 1: 173,677,696 probably benign Het
Kri1 CTCCTCCT C 9: 21,281,068 probably null Het
Krtap28-10 CACAGC CACAGCCACAGCCACAACAGC 1: 83,042,285 probably benign Het
Lrmp TG TGAGCACATGG 6: 145,173,790 probably benign Het
Med12l AGC AGCGGC 3: 59,275,967 probably benign Het
Med12l CAG CAGAAG 3: 59,275,981 probably benign Het
Mn1 CAG CAGAAG 5: 111,419,705 probably benign Het
Mnd1 G A 3: 84,134,059 L79F possibly damaging Het
Nolc1 AGCAGCAGC AGCAGCAGCGGCAGCAGC 19: 46,081,363 probably benign Het
Papd7 GACA G 13: 69,533,854 probably benign Het
Pdcd11 GGAGGAG GG 19: 47,113,449 probably null Het
Rbfox2 G T 15: 77,132,773 Q134K possibly damaging Het
Tcof1 AGC AGCTGC 18: 60,835,736 probably benign Het
Ttf2 TTCT TTCTTCT 3: 100,963,157 probably benign Het
Ubtf CTTC CTTCTTC 11: 102,306,945 probably benign Het
Vmn2r58 CAAAATGATGTAGCACTT C 7: 41,836,959 probably null Het
Zfhx3 CAGCAGCA CAGCAGCAAGAGCAGCA 8: 108,956,098 probably benign Het
Zfp384 CCCAGGC CCCAGGCCCAGGACCAGGC 6: 125,036,490 probably benign Het
Other mutations in Lor
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4589:Lor UTSW 3 92081894 frame shift probably null
R2932:Lor UTSW 3 92081878 small deletion probably benign
R4677:Lor UTSW 3 92081743 missense unknown
R5454:Lor UTSW 3 92081482 missense unknown
R5851:Lor UTSW 3 92080539 missense unknown
R6267:Lor UTSW 3 92081812 nonsense probably null
R7219:Lor UTSW 3 92081398 missense unknown
R7430:Lor UTSW 3 92081899 missense unknown
R7780:Lor UTSW 3 92081153 nonsense probably null
R8983:Lor UTSW 3 92081139 missense unknown
RF028:Lor UTSW 3 92081899 frame shift probably null
RF031:Lor UTSW 3 92081876 small deletion probably benign
X0057:Lor UTSW 3 92081878 small deletion probably benign
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2019-12-04