Incidental Mutation 'RF027:Zfp384'
ID604188
Institutional Source Beutler Lab
Gene Symbol Zfp384
Ensembl Gene ENSMUSG00000038346
Gene Namezinc finger protein 384
SynonymsC130073D16Rik, Nmp4, Ciz
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.272) question?
Stock #RF027 (G1)
Quality Score217.468
Status Not validated
Chromosome6
Chromosomal Location125009145-125037870 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) CCCAGGC to CCCAGGCCCAGGACCAGGC at 125036490 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032480] [ENSMUST00000046064] [ENSMUST00000054553] [ENSMUST00000084275] [ENSMUST00000088308] [ENSMUST00000112417] [ENSMUST00000112424] [ENSMUST00000112425] [ENSMUST00000112427] [ENSMUST00000112428] [ENSMUST00000140131]
Predicted Effect probably benign
Transcript: ENSMUST00000032480
SMART Domains Protein: ENSMUSP00000032480
Gene: ENSMUSG00000030330

DomainStartEndE-ValueType
Pfam:ING 5 107 5.5e-35 PFAM
low complexity region 118 131 N/A INTRINSIC
PHD 197 242 3.67e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000046064
SMART Domains Protein: ENSMUSP00000037986
Gene: ENSMUSG00000038346

DomainStartEndE-ValueType
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 260 282 3.47e0 SMART
ZnF_C2H2 288 310 2.99e-4 SMART
ZnF_C2H2 316 338 1.95e-3 SMART
ZnF_C2H2 344 368 7.37e-4 SMART
ZnF_C2H2 374 396 5.06e-2 SMART
ZnF_C2H2 404 426 3.44e-4 SMART
low complexity region 432 490 N/A INTRINSIC
low complexity region 491 496 N/A INTRINSIC
low complexity region 499 519 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000054553
SMART Domains Protein: ENSMUSP00000086354
Gene: ENSMUSG00000038346

DomainStartEndE-ValueType
low complexity region 133 144 N/A INTRINSIC
ZnF_C2H2 174 196 7.26e-3 SMART
ZnF_C2H2 202 224 2.99e-4 SMART
ZnF_C2H2 230 252 1.95e-3 SMART
ZnF_C2H2 258 282 7.37e-4 SMART
ZnF_C2H2 288 310 5.06e-2 SMART
ZnF_C2H2 318 340 3.44e-4 SMART
low complexity region 346 404 N/A INTRINSIC
low complexity region 405 410 N/A INTRINSIC
low complexity region 413 433 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084275
SMART Domains Protein: ENSMUSP00000081296
Gene: ENSMUSG00000038346

DomainStartEndE-ValueType
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 229 251 7.26e-3 SMART
ZnF_C2H2 257 279 2.99e-4 SMART
ZnF_C2H2 285 307 1.95e-3 SMART
ZnF_C2H2 318 340 7.37e-4 SMART
ZnF_C2H2 346 368 2.95e-3 SMART
ZnF_C2H2 374 398 7.37e-4 SMART
ZnF_C2H2 404 426 5.06e-2 SMART
ZnF_C2H2 434 456 3.44e-4 SMART
low complexity region 462 520 N/A INTRINSIC
low complexity region 521 526 N/A INTRINSIC
low complexity region 529 549 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088308
SMART Domains Protein: ENSMUSP00000085648
Gene: ENSMUSG00000038346

DomainStartEndE-ValueType
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 229 251 7.26e-3 SMART
ZnF_C2H2 257 279 2.99e-4 SMART
ZnF_C2H2 285 307 1.95e-3 SMART
ZnF_C2H2 318 340 7.37e-4 SMART
ZnF_C2H2 346 368 2.95e-3 SMART
ZnF_C2H2 374 398 7.37e-4 SMART
ZnF_C2H2 404 426 5.06e-2 SMART
ZnF_C2H2 434 456 3.44e-4 SMART
low complexity region 462 520 N/A INTRINSIC
low complexity region 521 526 N/A INTRINSIC
low complexity region 529 549 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112417
SMART Domains Protein: ENSMUSP00000108036
Gene: ENSMUSG00000030330

DomainStartEndE-ValueType
Pfam:ING 5 107 6.5e-35 PFAM
low complexity region 118 126 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112424
SMART Domains Protein: ENSMUSP00000108043
Gene: ENSMUSG00000038346

DomainStartEndE-ValueType
low complexity region 172 183 N/A INTRINSIC
ZnF_C2H2 213 235 7.26e-3 SMART
ZnF_C2H2 241 263 2.99e-4 SMART
ZnF_C2H2 269 291 1.95e-3 SMART
ZnF_C2H2 302 324 7.37e-4 SMART
ZnF_C2H2 330 352 2.95e-3 SMART
ZnF_C2H2 358 382 7.37e-4 SMART
ZnF_C2H2 388 410 5.06e-2 SMART
ZnF_C2H2 418 440 3.44e-4 SMART
low complexity region 446 504 N/A INTRINSIC
low complexity region 505 510 N/A INTRINSIC
low complexity region 513 533 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112425
SMART Domains Protein: ENSMUSP00000108044
Gene: ENSMUSG00000038346

DomainStartEndE-ValueType
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 229 251 7.26e-3 SMART
ZnF_C2H2 257 279 2.99e-4 SMART
ZnF_C2H2 285 307 1.95e-3 SMART
ZnF_C2H2 313 337 7.37e-4 SMART
ZnF_C2H2 343 365 5.06e-2 SMART
ZnF_C2H2 373 395 3.44e-4 SMART
low complexity region 401 459 N/A INTRINSIC
low complexity region 460 465 N/A INTRINSIC
low complexity region 468 488 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112427
SMART Domains Protein: ENSMUSP00000108046
Gene: ENSMUSG00000038346

DomainStartEndE-ValueType
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 229 251 7.26e-3 SMART
ZnF_C2H2 257 279 2.99e-4 SMART
ZnF_C2H2 285 307 1.95e-3 SMART
ZnF_C2H2 318 340 7.37e-4 SMART
ZnF_C2H2 346 368 2.95e-3 SMART
ZnF_C2H2 374 398 7.37e-4 SMART
ZnF_C2H2 404 426 5.06e-2 SMART
ZnF_C2H2 434 456 3.44e-4 SMART
low complexity region 462 520 N/A INTRINSIC
low complexity region 521 526 N/A INTRINSIC
low complexity region 529 549 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112428
SMART Domains Protein: ENSMUSP00000108047
Gene: ENSMUSG00000038346

DomainStartEndE-ValueType
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 260 282 3.47e0 SMART
ZnF_C2H2 288 310 2.99e-4 SMART
ZnF_C2H2 316 338 1.95e-3 SMART
ZnF_C2H2 344 368 7.37e-4 SMART
ZnF_C2H2 374 396 5.06e-2 SMART
ZnF_C2H2 404 426 3.44e-4 SMART
low complexity region 432 490 N/A INTRINSIC
low complexity region 491 496 N/A INTRINSIC
low complexity region 499 519 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140131
SMART Domains Protein: ENSMUSP00000121519
Gene: ENSMUSG00000030330

DomainStartEndE-ValueType
Pfam:ING 6 107 2.1e-35 PFAM
low complexity region 114 139 N/A INTRINSIC
PHD 198 243 3.67e-12 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a C2H2-type zinc finger protein, which may function as a transcription factor. This gene also contains long CAG trinucleotide repeats that encode consecutive glutamine residues. The protein appears to bind and regulate the promoters of the extracellular matrix genes MMP1, MMP3, MMP7 and COL1A1. Studies in mouse suggest that nuclear matrix transcription factors (NP/NMP4) may be part of a general mechanical pathway that couples cell construction and function during extracellular matrix remodeling. Alternative splicing results in multiple transcript variants. Recurrent rearrangements of this gene with the Ewing's sarcoma gene, EWSR1 on chromosome 22, or with the TAF15 gene on chromosome 17, or with the TCF3 (E2A) gene on chromosome 19, have been observed in acute leukemia. A related pseudogene has been identified on chromosome 7. [provided by RefSeq, Apr 2011]
PHENOTYPE: Homozygous mice are small and males have a small testis. Some males develop infertility and exhibit variable degrees of spermatogenic cell degeneration within the seminiferous tubules and increased apoptosis of spermatogenic cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik CTC CTCGTC 2: 130,770,744 probably benign Het
Blm CCTCCTCCTCCTC CCTCCTCCTCCTCTCCTCCTCCTC 7: 80,512,914 probably null Het
Cacna1f GAG GAGTAG X: 7,620,054 probably null Het
Ccdc170 ACC ACCTCC 10: 4,561,026 probably benign Het
Cul9 CTTC CTTCTTC 17: 46,500,848 probably benign Het
Cyb5r4 AGACACACTGCCCAGG AGACACACTGCCCAGGTATGTGACCGACACACTGCCCAGG 9: 87,040,431 probably benign Het
Dmkn GTGGA GTGGACGTGGTGGAAGTGGTGGAAGTGTTGGA 7: 30,767,194 probably benign Het
Dnah8 CCCTCCCG C 17: 30,635,476 probably null Het
Fam171b AGCAGC AGCAGCTGCAGC 2: 83,812,876 probably benign Het
Flywch1 TCACTCACCCACTCCTGGTGT TCACTCACCCACTCCTGGTGTGGGGAGGCTACGCACTCACCCACTCCTGGTGT 17: 23,762,158 probably null Het
Ifi208 AGATG AG 1: 173,677,696 probably benign Het
Kri1 CTCCTCCT C 9: 21,281,068 probably null Het
Krtap28-10 CACAGC CACAGCCACAGCCACAACAGC 1: 83,042,285 probably benign Het
Lor ATAGCCG A 3: 92,081,876 probably benign Het
Lrmp TG TGAGCACATGG 6: 145,173,790 probably benign Het
Med12l AGC AGCGGC 3: 59,275,967 probably benign Het
Med12l CAG CAGAAG 3: 59,275,981 probably benign Het
Mn1 CAG CAGAAG 5: 111,419,705 probably benign Het
Mnd1 G A 3: 84,134,059 L79F possibly damaging Het
Nolc1 AGCAGCAGC AGCAGCAGCGGCAGCAGC 19: 46,081,363 probably benign Het
Papd7 GACA G 13: 69,533,854 probably benign Het
Pdcd11 GGAGGAG GG 19: 47,113,449 probably null Het
Rbfox2 G T 15: 77,132,773 Q134K possibly damaging Het
Tcof1 AGC AGCTGC 18: 60,835,736 probably benign Het
Ttf2 TTCT TTCTTCT 3: 100,963,157 probably benign Het
Ubtf CTTC CTTCTTC 11: 102,306,945 probably benign Het
Vmn2r58 CAAAATGATGTAGCACTT C 7: 41,836,959 probably null Het
Zfhx3 CAGCAGCA CAGCAGCAAGAGCAGCA 8: 108,956,098 probably benign Het
Other mutations in Zfp384
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Zfp384 APN 6 125025053 missense probably benign 0.03
IGL01568:Zfp384 APN 6 125024132 missense probably damaging 1.00
IGL01632:Zfp384 APN 6 125024761 missense probably damaging 1.00
IGL03408:Zfp384 APN 6 125035713 missense probably damaging 1.00
FR4304:Zfp384 UTSW 6 125036493 unclassified probably benign
FR4340:Zfp384 UTSW 6 125036463 unclassified probably benign
R0839:Zfp384 UTSW 6 125036668 missense probably benign 0.01
R1370:Zfp384 UTSW 6 125036453 missense probably benign 0.04
R1427:Zfp384 UTSW 6 125024884 missense probably damaging 1.00
R2441:Zfp384 UTSW 6 125036649 missense probably benign 0.01
R2986:Zfp384 UTSW 6 125024896 missense possibly damaging 0.78
R4003:Zfp384 UTSW 6 125033237 splice site probably benign
R4833:Zfp384 UTSW 6 125030848 missense probably damaging 1.00
R4860:Zfp384 UTSW 6 125030930 synonymous silent
R5084:Zfp384 UTSW 6 125023679 splice site probably benign
R5137:Zfp384 UTSW 6 125036509 unclassified probably benign
R5449:Zfp384 UTSW 6 125024138 missense probably damaging 1.00
R5558:Zfp384 UTSW 6 125036509 unclassified probably benign
R5720:Zfp384 UTSW 6 125036624 missense probably benign 0.19
R5849:Zfp384 UTSW 6 125024099 missense possibly damaging 0.91
R5961:Zfp384 UTSW 6 125024034 missense probably damaging 1.00
R6165:Zfp384 UTSW 6 125024933 unclassified probably null
R6948:Zfp384 UTSW 6 125024910 missense probably benign 0.08
R7106:Zfp384 UTSW 6 125024259 missense probably benign 0.23
R7192:Zfp384 UTSW 6 125033312 missense probably damaging 1.00
R7320:Zfp384 UTSW 6 125024830 missense possibly damaging 0.92
R7730:Zfp384 UTSW 6 125031672 missense probably benign 0.02
R7861:Zfp384 UTSW 6 125036325 missense probably damaging 1.00
R7944:Zfp384 UTSW 6 125036325 missense probably damaging 1.00
RF002:Zfp384 UTSW 6 125036471 unclassified probably benign
RF003:Zfp384 UTSW 6 125036471 unclassified probably benign
RF003:Zfp384 UTSW 6 125036476 unclassified probably benign
RF003:Zfp384 UTSW 6 125036483 unclassified probably benign
RF010:Zfp384 UTSW 6 125036471 unclassified probably benign
RF010:Zfp384 UTSW 6 125036488 unclassified probably benign
RF011:Zfp384 UTSW 6 125036476 unclassified probably benign
RF014:Zfp384 UTSW 6 125036466 unclassified probably benign
RF015:Zfp384 UTSW 6 125036481 unclassified probably benign
RF018:Zfp384 UTSW 6 125036489 unclassified probably benign
RF020:Zfp384 UTSW 6 125036455 unclassified probably benign
RF020:Zfp384 UTSW 6 125036488 unclassified probably benign
RF022:Zfp384 UTSW 6 125036471 unclassified probably benign
RF024:Zfp384 UTSW 6 125036489 unclassified probably benign
RF026:Zfp384 UTSW 6 125036492 unclassified probably benign
RF030:Zfp384 UTSW 6 125036483 unclassified probably benign
RF056:Zfp384 UTSW 6 125036490 unclassified probably benign
RF057:Zfp384 UTSW 6 125036496 unclassified probably benign
RF062:Zfp384 UTSW 6 125036466 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGAGCCCAGGTTGAGACTTG -3'
(R):5'- ATGCTCTGCCGGCTTATAGG -3'

Sequencing Primer
(F):5'- TCTCCCTCAGGAAACATACCTTATG -3'
(R):5'- CCGGCTTATAGGGGGTCAAGTC -3'
Posted On2019-12-04