Incidental Mutation 'RF027:Papd7'
ID604198
Institutional Source Beutler Lab
Gene Symbol Papd7
Ensembl Gene ENSMUSG00000034575
Gene NamePAP associated domain containing 7
SynonymsPols, LAK-1, TRF4, TRF4-1
Accession Numbers

Ncbi RefSeq: NM_198600.2, NM_001169131.1; MGI: 2682295

Is this an essential gene? Possibly non essential (E-score: 0.256) question?
Stock #RF027 (G1)
Quality Score170.457
Status Not validated
Chromosome13
Chromosomal Location69497959-69534617 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) GACA to G at 69533854 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044081] [ENSMUST00000143716] [ENSMUST00000198607] [ENSMUST00000223344]
Predicted Effect probably benign
Transcript: ENSMUST00000044081
SMART Domains Protein: ENSMUSP00000040757
Gene: ENSMUSG00000034575

DomainStartEndE-ValueType
Pfam:NTP_transf_2 15 124 4.1e-20 PFAM
Pfam:PAP_assoc 178 238 5.4e-19 PFAM
low complexity region 343 368 N/A INTRINSIC
low complexity region 496 505 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143716
Predicted Effect probably benign
Transcript: ENSMUST00000198607
SMART Domains Protein: ENSMUSP00000142516
Gene: ENSMUSG00000034575

DomainStartEndE-ValueType
low complexity region 46 98 N/A INTRINSIC
low complexity region 106 118 N/A INTRINSIC
low complexity region 122 145 N/A INTRINSIC
low complexity region 206 220 N/A INTRINSIC
Pfam:NTP_transf_2 258 368 1.6e-14 PFAM
Pfam:PAP_assoc 421 481 8.3e-16 PFAM
low complexity region 586 611 N/A INTRINSIC
low complexity region 739 748 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223344
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a DNA polymerase that is likely involved in DNA repair. In addition, the encoded protein may be required for sister chromatid adhesion. Alternatively spliced transcript variants that encode different isoforms have been described. [provided by RefSeq, Jan 2010]
Allele List at MGI

All alleles(5) : Targeted(4) Gene trapped(1)

Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik CTC CTCGTC 2: 130,770,744 probably benign Het
Blm CCTCCTCCTCCTC CCTCCTCCTCCTCTCCTCCTCCTC 7: 80,512,914 probably null Het
Cacna1f GAG GAGTAG X: 7,620,054 probably null Het
Ccdc170 ACC ACCTCC 10: 4,561,026 probably benign Het
Cul9 CTTC CTTCTTC 17: 46,500,848 probably benign Het
Cyb5r4 AGACACACTGCCCAGG AGACACACTGCCCAGGTATGTGACCGACACACTGCCCAGG 9: 87,040,431 probably benign Het
Dmkn GTGGA GTGGACGTGGTGGAAGTGGTGGAAGTGTTGGA 7: 30,767,194 probably benign Het
Dnah8 CCCTCCCG C 17: 30,635,476 probably null Het
Fam171b AGCAGC AGCAGCTGCAGC 2: 83,812,876 probably benign Het
Flywch1 TCACTCACCCACTCCTGGTGT TCACTCACCCACTCCTGGTGTGGGGAGGCTACGCACTCACCCACTCCTGGTGT 17: 23,762,158 probably null Het
Ifi208 AGATG AG 1: 173,677,696 probably benign Het
Kri1 CTCCTCCT C 9: 21,281,068 probably null Het
Krtap28-10 CACAGC CACAGCCACAGCCACAACAGC 1: 83,042,285 probably benign Het
Lor ATAGCCG A 3: 92,081,876 probably benign Het
Lrmp TG TGAGCACATGG 6: 145,173,790 probably benign Het
Med12l AGC AGCGGC 3: 59,275,967 probably benign Het
Med12l CAG CAGAAG 3: 59,275,981 probably benign Het
Mn1 CAG CAGAAG 5: 111,419,705 probably benign Het
Mnd1 G A 3: 84,134,059 L79F possibly damaging Het
Nolc1 AGCAGCAGC AGCAGCAGCGGCAGCAGC 19: 46,081,363 probably benign Het
Pdcd11 GGAGGAG GG 19: 47,113,449 probably null Het
Rbfox2 G T 15: 77,132,773 Q134K possibly damaging Het
Tcof1 AGC AGCTGC 18: 60,835,736 probably benign Het
Ttf2 TTCT TTCTTCT 3: 100,963,157 probably benign Het
Ubtf CTTC CTTCTTC 11: 102,306,945 probably benign Het
Vmn2r58 CAAAATGATGTAGCACTT C 7: 41,836,959 probably null Het
Zfhx3 CAGCAGCA CAGCAGCAAGAGCAGCA 8: 108,956,098 probably benign Het
Zfp384 CCCAGGC CCCAGGCCCAGGACCAGGC 6: 125,036,490 probably benign Het
Other mutations in Papd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01537:Papd7 APN 13 69500559 missense probably benign 0.02
IGL02690:Papd7 APN 13 69510625 missense probably benign 0.01
IGL03047:Papd7 UTSW 13 69502911 missense probably damaging 1.00
P0027:Papd7 UTSW 13 69506955 nonsense probably null
R0309:Papd7 UTSW 13 69499932 missense possibly damaging 0.95
R1713:Papd7 UTSW 13 69503051 missense probably benign 0.10
R2936:Papd7 UTSW 13 69502327 missense possibly damaging 0.82
R3809:Papd7 UTSW 13 69512996 missense probably damaging 0.98
R4927:Papd7 UTSW 13 69502900 splice site probably null
R6419:Papd7 UTSW 13 69510666 missense possibly damaging 0.91
R7011:Papd7 UTSW 13 69500080 missense probably damaging 1.00
R7505:Papd7 UTSW 13 69506928 missense probably damaging 1.00
R7547:Papd7 UTSW 13 69533704 missense probably benign 0.04
R7554:Papd7 UTSW 13 69500072 missense probably damaging 1.00
R8040:Papd7 UTSW 13 69500481 missense probably damaging 0.99
RF039:Papd7 UTSW 13 69533854 unclassified probably benign
T0722:Papd7 UTSW 13 69506955 nonsense probably null
Z1177:Papd7 UTSW 13 69503634 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATACGTGCTGGCCTTGTTC -3'
(R):5'- TGTGGATGCAGATCTGGGAGAC -3'

Sequencing Primer
(F):5'- ACCCGGGTGGAACTGGTG -3'
(R):5'- TCTGCCTCAACTCGCCGG -3'
Posted On2019-12-04