Incidental Mutation 'RF027:Rbfox2'
ID604199
Institutional Source Beutler Lab
Gene Symbol Rbfox2
Ensembl Gene ENSMUSG00000033565
Gene NameRNA binding protein, fox-1 homolog (C. elegans) 2
Synonyms2810460A15Rik, Fxh, Fbm2, Rbm9
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.688) question?
Stock #RF027 (G1)
Quality Score213.009
Status Not validated
Chromosome15
Chromosomal Location77078990-77307004 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 77132773 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 134 (Q134K)
Ref Sequence ENSEMBL: ENSMUSP00000130739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048145] [ENSMUST00000111581] [ENSMUST00000166610] [ENSMUST00000171751] [ENSMUST00000227314] [ENSMUST00000227533] [ENSMUST00000227930] [ENSMUST00000228087] [ENSMUST00000228558] [ENSMUST00000228582]
Predicted Effect probably damaging
Transcript: ENSMUST00000048145
AA Change: Q134K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000048056
Gene: ENSMUSG00000033565
AA Change: Q134K

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
low complexity region 91 107 N/A INTRINSIC
low complexity region 139 150 N/A INTRINSIC
low complexity region 156 178 N/A INTRINSIC
RRM 181 252 1.77e-24 SMART
Pfam:Fox-1_C 319 374 2.9e-18 PFAM
low complexity region 375 390 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111581
AA Change: Q66K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000129372
Gene: ENSMUSG00000033565
AA Change: Q66K

DomainStartEndE-ValueType
low complexity region 23 39 N/A INTRINSIC
low complexity region 71 82 N/A INTRINSIC
low complexity region 88 110 N/A INTRINSIC
RRM 113 184 1.77e-24 SMART
Pfam:Fox-1_C 252 350 3.7e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166610
AA Change: Q66K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130673
Gene: ENSMUSG00000033565
AA Change: Q66K

DomainStartEndE-ValueType
low complexity region 23 39 N/A INTRINSIC
low complexity region 71 82 N/A INTRINSIC
low complexity region 88 110 N/A INTRINSIC
RRM 113 184 1.77e-24 SMART
Pfam:Fox-1_C 255 353 6.2e-41 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000171751
AA Change: Q134K

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000130739
Gene: ENSMUSG00000033565
AA Change: Q134K

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
low complexity region 91 107 N/A INTRINSIC
low complexity region 139 150 N/A INTRINSIC
low complexity region 156 178 N/A INTRINSIC
RRM 181 252 1.77e-24 SMART
Pfam:Fox-1_C 324 421 7e-47 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000227314
AA Change: Q66K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000227533
AA Change: Q66K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227930
AA Change: Q66K

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably damaging
Transcript: ENSMUST00000228087
AA Change: Q66K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000228558
AA Change: Q88K

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect possibly damaging
Transcript: ENSMUST00000228582
AA Change: Q117K

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of several human genes similar to the C. elegans gene Fox-1. This gene encodes an RNA binding protein that is thought to be a key regulator of alternative exon splicing in the nervous system and other cell types. The protein binds to a conserved UGCAUG element found downstream of many alternatively spliced exons and promotes inclusion of the alternative exon in mature transcripts. The protein also interacts with the estrogen receptor 1 transcription factor and regulates estrogen receptor 1 transcriptional activity. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele activated in the brain exhibit normal spontaneous and kainic acid-induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik CTC CTCGTC 2: 130,770,744 probably benign Het
Blm CCTCCTCCTCCTC CCTCCTCCTCCTCTCCTCCTCCTC 7: 80,512,914 probably null Het
Cacna1f GAG GAGTAG X: 7,620,054 probably null Het
Ccdc170 ACC ACCTCC 10: 4,561,026 probably benign Het
Cul9 CTTC CTTCTTC 17: 46,500,848 probably benign Het
Cyb5r4 AGACACACTGCCCAGG AGACACACTGCCCAGGTATGTGACCGACACACTGCCCAGG 9: 87,040,431 probably benign Het
Dmkn GTGGA GTGGACGTGGTGGAAGTGGTGGAAGTGTTGGA 7: 30,767,194 probably benign Het
Dnah8 CCCTCCCG C 17: 30,635,476 probably null Het
Fam171b AGCAGC AGCAGCTGCAGC 2: 83,812,876 probably benign Het
Flywch1 TCACTCACCCACTCCTGGTGT TCACTCACCCACTCCTGGTGTGGGGAGGCTACGCACTCACCCACTCCTGGTGT 17: 23,762,158 probably null Het
Ifi208 AGATG AG 1: 173,677,696 probably benign Het
Kri1 CTCCTCCT C 9: 21,281,068 probably null Het
Krtap28-10 CACAGC CACAGCCACAGCCACAACAGC 1: 83,042,285 probably benign Het
Lor ATAGCCG A 3: 92,081,876 probably benign Het
Lrmp TG TGAGCACATGG 6: 145,173,790 probably benign Het
Med12l AGC AGCGGC 3: 59,275,967 probably benign Het
Med12l CAG CAGAAG 3: 59,275,981 probably benign Het
Mn1 CAG CAGAAG 5: 111,419,705 probably benign Het
Mnd1 G A 3: 84,134,059 L79F possibly damaging Het
Nolc1 AGCAGCAGC AGCAGCAGCGGCAGCAGC 19: 46,081,363 probably benign Het
Papd7 GACA G 13: 69,533,854 probably benign Het
Pdcd11 GGAGGAG GG 19: 47,113,449 probably null Het
Tcof1 AGC AGCTGC 18: 60,835,736 probably benign Het
Ttf2 TTCT TTCTTCT 3: 100,963,157 probably benign Het
Ubtf CTTC CTTCTTC 11: 102,306,945 probably benign Het
Vmn2r58 CAAAATGATGTAGCACTT C 7: 41,836,959 probably null Het
Zfhx3 CAGCAGCA CAGCAGCAAGAGCAGCA 8: 108,956,098 probably benign Het
Zfp384 CCCAGGC CCCAGGCCCAGGACCAGGC 6: 125,036,490 probably benign Het
Other mutations in Rbfox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Rbfox2 APN 15 77102936 missense probably damaging 1.00
R0026:Rbfox2 UTSW 15 77084157 missense possibly damaging 0.66
R0130:Rbfox2 UTSW 15 77091857 intron probably benign
R0446:Rbfox2 UTSW 15 77099255 missense probably damaging 0.98
R0731:Rbfox2 UTSW 15 77099279 missense probably benign 0.21
R3013:Rbfox2 UTSW 15 77132920 missense probably damaging 1.00
R3715:Rbfox2 UTSW 15 77099251 missense probably damaging 0.97
R4094:Rbfox2 UTSW 15 77132725 missense probably damaging 0.99
R4543:Rbfox2 UTSW 15 77306368 missense probably benign 0.01
R4799:Rbfox2 UTSW 15 77091818 missense probably benign 0.28
R6194:Rbfox2 UTSW 15 77084157 missense possibly damaging 0.66
R7316:Rbfox2 UTSW 15 77132729 missense possibly damaging 0.92
R7501:Rbfox2 UTSW 15 77105634 missense probably benign 0.36
R7687:Rbfox2 UTSW 15 77306494 missense unknown
R8030:Rbfox2 UTSW 15 77085576 critical splice donor site probably null
R8103:Rbfox2 UTSW 15 77099454 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACATGCATGCTGGGCAGTG -3'
(R):5'- AGAACATGCTAAGAGTCCTGTG -3'

Sequencing Primer
(F):5'- CATGCTGGGCAGTGAGTAG -3'
(R):5'- CATGCTAAGAGTCCTGTGTGATAAAG -3'
Posted On2019-12-04