Incidental Mutation 'RF027:Nolc1'
Institutional Source Beutler Lab
Gene Symbol Nolc1
Ensembl Gene ENSMUSG00000015176
Gene Namenucleolar and coiled-body phosphoprotein 1
SynonymsNOPP140, 3230402K17Rik, P130
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF027 (G1)
Quality Score217.468
Status Not validated
Chromosomal Location46075863-46085530 bp(+) (GRCm38)
Type of Mutationsmall insertion (3 aa in frame mutation)
DNA Base Change (assembly) AGCAGCAGC to AGCAGCAGCGGCAGCAGC at 46081363 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165017] [ENSMUST00000223728] [ENSMUST00000223741] [ENSMUST00000224490] [ENSMUST00000225780]
Predicted Effect probably benign
Transcript: ENSMUST00000165017
SMART Domains Protein: ENSMUSP00000128331
Gene: ENSMUSG00000015176

LisH 10 42 2.3e-2 SMART
low complexity region 76 100 N/A INTRINSIC
low complexity region 123 187 N/A INTRINSIC
low complexity region 189 210 N/A INTRINSIC
low complexity region 224 272 N/A INTRINSIC
low complexity region 273 285 N/A INTRINSIC
low complexity region 297 313 N/A INTRINSIC
low complexity region 315 328 N/A INTRINSIC
low complexity region 329 342 N/A INTRINSIC
low complexity region 353 383 N/A INTRINSIC
low complexity region 429 470 N/A INTRINSIC
low complexity region 472 486 N/A INTRINSIC
low complexity region 489 501 N/A INTRINSIC
low complexity region 509 538 N/A INTRINSIC
low complexity region 558 579 N/A INTRINSIC
Pfam:SRP40_C 627 699 1.1e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223683
Predicted Effect probably benign
Transcript: ENSMUST00000223728
Predicted Effect probably benign
Transcript: ENSMUST00000223741
Predicted Effect probably benign
Transcript: ENSMUST00000224490
Predicted Effect probably benign
Transcript: ENSMUST00000225780
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik CTC CTCGTC 2: 130,770,744 probably benign Het
Cacna1f GAG GAGTAG X: 7,620,054 probably null Het
Ccdc170 ACC ACCTCC 10: 4,561,026 probably benign Het
Cul9 CTTC CTTCTTC 17: 46,500,848 probably benign Het
Dnah8 CCCTCCCG C 17: 30,635,476 probably null Het
Fam171b AGCAGC AGCAGCTGCAGC 2: 83,812,876 probably benign Het
Ifi208 AGATG AG 1: 173,677,696 probably benign Het
Kri1 CTCCTCCT C 9: 21,281,068 probably null Het
Krtap28-10 CACAGC CACAGCCACAGCCACAACAGC 1: 83,042,285 probably benign Het
Lor ATAGCCG A 3: 92,081,876 probably benign Het
Lrmp TG TGAGCACATGG 6: 145,173,790 probably benign Het
Med12l AGC AGCGGC 3: 59,275,967 probably benign Het
Med12l CAG CAGAAG 3: 59,275,981 probably benign Het
Mn1 CAG CAGAAG 5: 111,419,705 probably benign Het
Mnd1 G A 3: 84,134,059 L79F possibly damaging Het
Papd7 GACA G 13: 69,533,854 probably benign Het
Pdcd11 GGAGGAG GG 19: 47,113,449 probably null Het
Rbfox2 G T 15: 77,132,773 Q134K possibly damaging Het
Tcof1 AGC AGCTGC 18: 60,835,736 probably benign Het
Ttf2 TTCT TTCTTCT 3: 100,963,157 probably benign Het
Ubtf CTTC CTTCTTC 11: 102,306,945 probably benign Het
Vmn2r58 CAAAATGATGTAGCACTT C 7: 41,836,959 probably null Het
Zfhx3 CAGCAGCA CAGCAGCAAGAGCAGCA 8: 108,956,098 probably benign Het
Zfp384 CCCAGGC CCCAGGCCCAGGACCAGGC 6: 125,036,490 probably benign Het
Other mutations in Nolc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02679:Nolc1 APN 19 46083029 unclassified probably benign
FR4976:Nolc1 UTSW 19 46081356 small insertion probably benign
FR4976:Nolc1 UTSW 19 46081375 small insertion probably benign
R0106:Nolc1 UTSW 19 46080089 splice site probably benign
R0121:Nolc1 UTSW 19 46081378 unclassified probably benign
R0140:Nolc1 UTSW 19 46081378 unclassified probably benign
R0501:Nolc1 UTSW 19 46078920 missense probably damaging 1.00
R0513:Nolc1 UTSW 19 46084159 missense probably damaging 1.00
R0676:Nolc1 UTSW 19 46080089 splice site probably benign
R1553:Nolc1 UTSW 19 46081375 small insertion probably benign
R1642:Nolc1 UTSW 19 46079022 critical splice donor site probably null
R1698:Nolc1 UTSW 19 46081431 splice site probably null
R2067:Nolc1 UTSW 19 46083607 missense probably damaging 1.00
R2113:Nolc1 UTSW 19 46081359 small insertion probably benign
R2113:Nolc1 UTSW 19 46081361 small insertion probably benign
R2300:Nolc1 UTSW 19 46081359 small insertion probably benign
R2300:Nolc1 UTSW 19 46081368 small insertion probably benign
R2895:Nolc1 UTSW 19 46081352 small insertion probably benign
R2999:Nolc1 UTSW 19 46083155 small deletion probably benign
R3737:Nolc1 UTSW 19 46081353 small insertion probably benign
R3737:Nolc1 UTSW 19 46081370 small insertion probably benign
R3737:Nolc1 UTSW 19 46081377 small insertion probably benign
R3747:Nolc1 UTSW 19 46081356 small insertion probably benign
R3806:Nolc1 UTSW 19 46081352 small insertion probably benign
R3807:Nolc1 UTSW 19 46081352 small insertion probably benign
R3807:Nolc1 UTSW 19 46081359 small insertion probably benign
R3807:Nolc1 UTSW 19 46081371 small insertion probably benign
R4035:Nolc1 UTSW 19 46081358 small insertion probably benign
R4619:Nolc1 UTSW 19 46083520 missense probably damaging 1.00
R4856:Nolc1 UTSW 19 46083155 small deletion probably benign
R4999:Nolc1 UTSW 19 46078920 missense probably damaging 1.00
R5103:Nolc1 UTSW 19 46081664 nonsense probably null
R5559:Nolc1 UTSW 19 46083155 small deletion probably benign
R5837:Nolc1 UTSW 19 46083183 unclassified probably benign
R6457:Nolc1 UTSW 19 46083070 unclassified probably benign
R7467:Nolc1 UTSW 19 46082334 missense unknown
R7497:Nolc1 UTSW 19 46082818 missense probably benign 0.23
R8011:Nolc1 UTSW 19 46081584 missense unknown
R8806:Nolc1 UTSW 19 46083032 missense unknown
RF031:Nolc1 UTSW 19 46081371 small insertion probably benign
RF034:Nolc1 UTSW 19 46081371 small insertion probably benign
RF040:Nolc1 UTSW 19 46081363 small insertion probably benign
RF044:Nolc1 UTSW 19 46081371 small insertion probably benign
X0050:Nolc1 UTSW 19 46081352 small deletion probably benign
Y5377:Nolc1 UTSW 19 46081369 small insertion probably benign
Y5379:Nolc1 UTSW 19 46081359 small insertion probably benign
Z1088:Nolc1 UTSW 19 46083098 unclassified probably benign
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-12-04