Incidental Mutation 'RF027:Pdcd11'
Institutional Source Beutler Lab
Gene Symbol Pdcd11
Ensembl Gene ENSMUSG00000025047
Gene Nameprogrammed cell death 11
SynonymsALG-4, 1110021I22Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock #RF027 (G1)
Quality Score217.468
Status Not validated
Chromosomal Location47090766-47131143 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GGAGGAG to GG at 47113449 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000072008 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072141] [ENSMUST00000140512]
Predicted Effect probably null
Transcript: ENSMUST00000072141
SMART Domains Protein: ENSMUSP00000072008
Gene: ENSMUSG00000025047

low complexity region 53 76 N/A INTRINSIC
S1 81 171 1.05e-7 SMART
S1 185 258 2.32e-9 SMART
S1 279 346 1.44e-5 SMART
S1 363 436 8.55e-8 SMART
S1 451 522 3.89e-20 SMART
S1 540 611 1.14e-17 SMART
S1 634 707 2.76e-2 SMART
S1 727 798 2.02e-18 SMART
low complexity region 813 823 N/A INTRINSIC
S1 844 911 6.13e0 SMART
Blast:S1 923 993 8e-39 BLAST
low complexity region 1018 1032 N/A INTRINSIC
S1 1045 1120 1.3e-7 SMART
S1 1158 1233 6.09e-4 SMART
S1 1239 1309 4.14e-6 SMART
S1 1333 1407 1.57e-6 SMART
low complexity region 1433 1473 N/A INTRINSIC
coiled coil region 1557 1588 N/A INTRINSIC
HAT 1591 1622 6.53e2 SMART
HAT 1624 1661 4.12e1 SMART
HAT 1663 1694 3.49e2 SMART
HAT 1696 1728 3.18e-1 SMART
HAT 1730 1764 2.25e2 SMART
HAT 1766 1798 8.52e-2 SMART
HAT 1800 1835 1.33e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140512
SMART Domains Protein: ENSMUSP00000121661
Gene: ENSMUSG00000033033

Pfam:Ca_hom_mod 6 258 2.9e-93 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PDCD11 is a NF-kappa-B (NFKB1; 164011)-binding protein that colocalizes with U3 RNA (MIM 180710) in the nucleolus and is required for rRNA maturation and generation of 18S rRNA (Sweet et al., 2003 [PubMed 14624448]; Sweet et al., 2008 [PubMed 17654514]).[supplied by OMIM, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik CTC CTCGTC 2: 130,770,744 probably benign Het
Cacna1f GAG GAGTAG X: 7,620,054 probably null Het
Ccdc170 ACC ACCTCC 10: 4,561,026 probably benign Het
Cul9 CTTC CTTCTTC 17: 46,500,848 probably benign Het
Dnah8 CCCTCCCG C 17: 30,635,476 probably null Het
Fam171b AGCAGC AGCAGCTGCAGC 2: 83,812,876 probably benign Het
Ifi208 AGATG AG 1: 173,677,696 probably benign Het
Kri1 CTCCTCCT C 9: 21,281,068 probably null Het
Krtap28-10 CACAGC CACAGCCACAGCCACAACAGC 1: 83,042,285 probably benign Het
Lor ATAGCCG A 3: 92,081,876 probably benign Het
Lrmp TG TGAGCACATGG 6: 145,173,790 probably benign Het
Med12l AGC AGCGGC 3: 59,275,967 probably benign Het
Med12l CAG CAGAAG 3: 59,275,981 probably benign Het
Mn1 CAG CAGAAG 5: 111,419,705 probably benign Het
Mnd1 G A 3: 84,134,059 L79F possibly damaging Het
Nolc1 AGCAGCAGC AGCAGCAGCGGCAGCAGC 19: 46,081,363 probably benign Het
Papd7 GACA G 13: 69,533,854 probably benign Het
Rbfox2 G T 15: 77,132,773 Q134K possibly damaging Het
Tcof1 AGC AGCTGC 18: 60,835,736 probably benign Het
Ttf2 TTCT TTCTTCT 3: 100,963,157 probably benign Het
Ubtf CTTC CTTCTTC 11: 102,306,945 probably benign Het
Vmn2r58 CAAAATGATGTAGCACTT C 7: 41,836,959 probably null Het
Zfhx3 CAGCAGCA CAGCAGCAAGAGCAGCA 8: 108,956,098 probably benign Het
Zfp384 CCCAGGC CCCAGGCCCAGGACCAGGC 6: 125,036,490 probably benign Het
Other mutations in Pdcd11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00646:Pdcd11 APN 19 47117328 missense possibly damaging 0.83
IGL00656:Pdcd11 APN 19 47098170 missense probably damaging 1.00
IGL00754:Pdcd11 APN 19 47103782 missense possibly damaging 0.86
IGL00907:Pdcd11 APN 19 47107564 missense probably benign 0.16
IGL00987:Pdcd11 APN 19 47114550 intron probably benign
IGL01346:Pdcd11 APN 19 47109614 missense probably benign 0.03
IGL01529:Pdcd11 APN 19 47109629 missense probably benign 0.01
IGL01670:Pdcd11 APN 19 47106304 missense probably damaging 0.98
IGL01917:Pdcd11 APN 19 47101165 missense possibly damaging 0.92
IGL02096:Pdcd11 APN 19 47106421 missense probably benign 0.10
IGL02300:Pdcd11 APN 19 47126942 missense probably benign
IGL02515:Pdcd11 APN 19 47125077 missense probably damaging 1.00
IGL02886:Pdcd11 APN 19 47113625 missense possibly damaging 0.95
IGL03158:Pdcd11 APN 19 47128061 missense possibly damaging 0.91
R0100:Pdcd11 UTSW 19 47102666 missense probably benign 0.00
R0100:Pdcd11 UTSW 19 47102666 missense probably benign 0.00
R0128:Pdcd11 UTSW 19 47119862 missense probably benign 0.15
R0139:Pdcd11 UTSW 19 47110959 critical splice acceptor site probably null
R0227:Pdcd11 UTSW 19 47113437 intron probably benign
R0316:Pdcd11 UTSW 19 47113172 missense probably damaging 0.97
R0480:Pdcd11 UTSW 19 47125037 intron probably benign
R0577:Pdcd11 UTSW 19 47098832 missense probably benign 0.01
R0725:Pdcd11 UTSW 19 47127291 missense probably benign 0.17
R1344:Pdcd11 UTSW 19 47130077 missense probably damaging 1.00
R1418:Pdcd11 UTSW 19 47130077 missense probably damaging 1.00
R1856:Pdcd11 UTSW 19 47098187 missense probably benign 0.00
R2146:Pdcd11 UTSW 19 47104752 missense probably benign 0.00
R2147:Pdcd11 UTSW 19 47104752 missense probably benign 0.00
R2447:Pdcd11 UTSW 19 47114556 missense probably benign 0.01
R2916:Pdcd11 UTSW 19 47113437 intron probably benign
R3177:Pdcd11 UTSW 19 47113264 missense probably damaging 1.00
R3277:Pdcd11 UTSW 19 47113264 missense probably damaging 1.00
R3712:Pdcd11 UTSW 19 47127245 intron probably benign
R4495:Pdcd11 UTSW 19 47111006 missense probably benign
R4697:Pdcd11 UTSW 19 47126347 missense possibly damaging 0.83
R4941:Pdcd11 UTSW 19 47119886 missense probably damaging 1.00
R4953:Pdcd11 UTSW 19 47127965 missense probably benign 0.04
R5048:Pdcd11 UTSW 19 47107115 missense probably benign
R5049:Pdcd11 UTSW 19 47107115 missense probably benign
R5103:Pdcd11 UTSW 19 47124454 missense probably benign 0.00
R5107:Pdcd11 UTSW 19 47106454 missense probably damaging 1.00
R5139:Pdcd11 UTSW 19 47107115 missense probably benign
R5261:Pdcd11 UTSW 19 47113537 missense probably benign
R5302:Pdcd11 UTSW 19 47107644 missense probably damaging 1.00
R5592:Pdcd11 UTSW 19 47102725 missense probably benign
R5769:Pdcd11 UTSW 19 47102637 missense possibly damaging 0.92
R5791:Pdcd11 UTSW 19 47110991 missense possibly damaging 0.65
R5809:Pdcd11 UTSW 19 47093808 missense probably benign 0.01
R5899:Pdcd11 UTSW 19 47104759 missense possibly damaging 0.93
R5901:Pdcd11 UTSW 19 47128332 missense possibly damaging 0.76
R5947:Pdcd11 UTSW 19 47129263 missense probably benign 0.20
R6177:Pdcd11 UTSW 19 47120283 missense probably damaging 1.00
R6489:Pdcd11 UTSW 19 47109752 missense probably damaging 1.00
R6575:Pdcd11 UTSW 19 47109678 missense probably damaging 0.98
R6578:Pdcd11 UTSW 19 47111081 missense probably benign 0.11
R7009:Pdcd11 UTSW 19 47113142 missense probably benign 0.17
R7015:Pdcd11 UTSW 19 47098226 missense probably benign 0.00
R7060:Pdcd11 UTSW 19 47110979 missense probably benign 0.30
R7260:Pdcd11 UTSW 19 47129234 missense possibly damaging 0.62
R7392:Pdcd11 UTSW 19 47127997 missense probably damaging 1.00
R7601:Pdcd11 UTSW 19 47106369 missense not run
R7759:Pdcd11 UTSW 19 47113198 missense possibly damaging 0.88
R7760:Pdcd11 UTSW 19 47113198 missense possibly damaging 0.88
R7785:Pdcd11 UTSW 19 47104686 missense probably benign 0.00
R7793:Pdcd11 UTSW 19 47106432 missense probably benign 0.00
R7810:Pdcd11 UTSW 19 47098220 missense possibly damaging 0.81
R7863:Pdcd11 UTSW 19 47096964 missense probably damaging 1.00
R7950:Pdcd11 UTSW 19 47113437 intron probably benign
R8062:Pdcd11 UTSW 19 47130713 missense possibly damaging 0.50
R8184:Pdcd11 UTSW 19 47113352 nonsense probably null
R8278:Pdcd11 UTSW 19 47106297 missense probably damaging 1.00
R8404:Pdcd11 UTSW 19 47104792 missense probably damaging 0.98
R8508:Pdcd11 UTSW 19 47119806 missense probably damaging 1.00
R8525:Pdcd11 UTSW 19 47092898 missense possibly damaging 0.52
R8787:Pdcd11 UTSW 19 47108580 missense probably damaging 1.00
RF010:Pdcd11 UTSW 19 47113451 frame shift probably null
RF039:Pdcd11 UTSW 19 47113455 frame shift probably null
RF061:Pdcd11 UTSW 19 47113445 frame shift probably null
X0065:Pdcd11 UTSW 19 47096896 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-12-04