Incidental Mutation 'RF028:A030005L19Rik'
ID604208
Institutional Source Beutler Lab
Gene Symbol A030005L19Rik
Ensembl Gene ENSMUSG00000113880
Gene NameRIKEN cDNA A030005L19 gene
Synonyms
Accession Numbers
Is this an essential gene? Not available question?
Stock #RF028 (G1)
Quality Score215.916
Status Not validated
Chromosome1
Chromosomal Location82913325-82914130 bp(+) (GRCm38)
Type of Mutationsmall insertion (3 aa in frame mutation)
DNA Base Change (assembly) TGTGGCTGC to TGTGGCTGCCGTGGCTGC at 82913580 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152156 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000220768
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 TGCATCCTGGGCTGC TGCATCCTGGGCTGCAGCATCCTGGGCTGC 4: 155,905,091 probably benign Het
Arid1b C CGGG 17: 4,995,598 probably benign Het
Blm CCTCCTCCTCCTCCTCCTCCTCCT CCTCCTCCTCCTACTCCTCCTCCTCCTCCTCCTCCT 7: 80,512,905 probably null Het
Boc GAC G 16: 44,496,433 probably null Het
Cacna1f GAG GAGAAG X: 7,620,060 probably benign Het
Cacna1f GAG GAGAAG X: 7,620,063 probably benign Het
Catsper2 ATCGCTTTCCTCGTTTTCG ATCG 2: 121,397,726 probably benign Het
Dbr1 GAGGAG GAGGAGTAGGAG 9: 99,583,697 probably null Het
E4f1 CGC CGCGGC 17: 24,455,190 probably benign Het
Eps8 TCGCTC TCGCTCGCTC 6: 137,517,063 probably benign Het
Ermn AACT AACTACT 2: 58,048,066 probably benign Het
Fsip2 TAGATGTGAAACCCTTAGAGGTAAGATGTGAAACTCTTAGAGGTAAGA TAGATGTGAAACTCTTAGAGGTAAGA 2: 82,994,008 probably null Het
Gab3 CTTCTT CTTATTCTT X: 75,000,000 probably null Het
Gab3 TCT TCTGCT X: 75,000,017 probably benign Het
Gabre CTC CTCTGGGTC X: 72,270,763 probably benign Het
Gm7579 GGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGATGCAAGGGAGGCTGTGGCTCCTGTGGGGG GGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGATGCAAGGGAGGCTGTGGCTCCTGTGGGGG 7: 142,212,045 probably benign Het
Gm8369 TG TGGGTGAG 19: 11,511,773 probably null Het
Hsdl2 CAGCTGCAG CAGCTGCAGCAGCAGCCATAGCTGCAG 4: 59,610,650 probably null Het
Iqcf4 TTTTCCTTTT TTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCGTTTCCTTTT 9: 106,570,614 probably benign Het
Kmt2e TTT TTTTATT 5: 23,478,509 probably benign Het
Kri1 CTCCTCCT C 9: 21,281,071 probably null Het
Krtap28-10 AGCCACAGCCACCACAGCCACAGCCACCAC AGCCACAGCCACCACCGCCACAGCCACCACAGCCACAGCCACCAC 1: 83,042,258 probably benign Het
Lce1m GTTGCTGCCACTG GTTGCTGCCACTGTTGCTGCCACTG 3: 93,018,131 probably benign Het
Lor CGCCGCCT C 3: 92,081,899 probably null Het
Luzp1 A AGGTGGCCTCTTCAGG 4: 136,543,196 probably benign Het
Lypd8 CCAACA CCAACAGGTCCCTCGCCTCTGTTACCCCACAAATAAACAACA 11: 58,390,239 probably benign Het
Mn1 CAG CAGGAG 5: 111,419,711 probably benign Het
Nefh GGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGACTTGGCCTCACCTGTGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,012 probably benign Het
Nefh GGGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGGACTTGGCCTCACCTTGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,029 probably benign Het
Nf2 AAAAG A 11: 4,829,936 probably null Het
Nusap1 AGAT AGATCCACGTTAGCAGTGAGGAGCAAGCTGCGAT 2: 119,627,578 probably benign Het
Nusap1 CAGTGAGGAGCAAGCTGAGA CAGTGAGGAGCAAGCTGAGATACACGTTAGTAGTGAGGAGCAAGCTGAGA 2: 119,627,591 probably benign Het
Phf20 CCCCCC CCCCCCGCCCCC 2: 156,304,623 probably benign Het
Ppp1r8 TCTCTCTCAC TC 4: 132,830,615 probably benign Het
Prr5l GCCTC G 2: 101,797,573 probably null Het
Rbm12 CGGGACCGGGCATTGCGGGACCGGGCATTGCGGG CGG 2: 156,096,130 probably null Het
Rpgrip1 GA GAGTA 14: 52,149,398 probably null Het
Tanc1 GTGAGCAGAAACCAGCATTTAGAGGGAACCGGTCCCTTCACTGCAGGAA G 2: 59,843,269 probably benign Het
Tfeb GCA GCATCA 17: 47,786,097 probably benign Het
Tgoln1 T TTGTCTTGTCAGAATCACCTCCTGG 6: 72,616,036 probably benign Het
Thegl AGCGATCCTCCCCAGTCCCGCAAGGCC AGCGATCCTCCCCAGTCCCGCAAGGCCCGCGATCCTCCCCAGTCCCGCAAGGCC 5: 77,016,401 probably benign Het
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Trappc9 GCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT GCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT 15: 72,801,290 probably benign Het
Triobp CAGGACT CAGGACTGCCTGTGCCCAACGGAACAACCCAAGGACT 15: 78,967,039 probably benign Het
Zfhx3 AACAGCAGC AACAGCAGCTACAGCAGC 8: 108,956,096 probably benign Het
Zfp933 TT TTTGCCT 4: 147,825,731 probably null Het
Other mutations in A030005L19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
RF001:A030005L19Rik UTSW 1 82913590 small insertion probably benign
RF005:A030005L19Rik UTSW 1 82913585 small insertion probably benign
RF011:A030005L19Rik UTSW 1 82913569 small insertion probably benign
RF011:A030005L19Rik UTSW 1 82913573 small insertion probably benign
RF011:A030005L19Rik UTSW 1 82913586 small insertion probably benign
RF016:A030005L19Rik UTSW 1 82913577 small insertion probably benign
RF018:A030005L19Rik UTSW 1 82913572 small insertion probably benign
RF021:A030005L19Rik UTSW 1 82913569 small insertion probably benign
RF023:A030005L19Rik UTSW 1 82913396 small deletion probably benign
RF028:A030005L19Rik UTSW 1 82913578 small insertion probably benign
RF034:A030005L19Rik UTSW 1 82913580 small insertion probably benign
RF035:A030005L19Rik UTSW 1 82913589 small insertion probably benign
RF038:A030005L19Rik UTSW 1 82913580 small insertion probably benign
RF040:A030005L19Rik UTSW 1 82913577 small insertion probably benign
RF040:A030005L19Rik UTSW 1 82913590 small insertion probably benign
RF042:A030005L19Rik UTSW 1 82913584 small insertion probably benign
RF044:A030005L19Rik UTSW 1 82913589 small insertion probably benign
RF053:A030005L19Rik UTSW 1 82913573 small insertion probably benign
RF059:A030005L19Rik UTSW 1 82913579 small insertion probably benign
RF060:A030005L19Rik UTSW 1 82913396 small deletion probably benign
RF060:A030005L19Rik UTSW 1 82913579 nonsense probably null
RF060:A030005L19Rik UTSW 1 82913587 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- CTGAGTCCTCTCTACTGACAAC -3'
(R):5'- ACCAGTGTGGCCTCCATATC -3'

Sequencing Primer
(F):5'- GAGTCCTCTCTACTGACAACATGGG -3'
(R):5'- GGCCTCCATATCTCCTAGGTAGG -3'
Posted On2019-12-04