Incidental Mutation 'RF028:Krtap28-10'
ID604209
Institutional Source Beutler Lab
Gene Symbol Krtap28-10
Ensembl Gene ENSMUSG00000100190
Gene Namekeratin associated protein 28-10
Synonyms4733401N17Rik
Accession Numbers
Is this an essential gene? Not available question?
Stock #RF028 (G1)
Quality Score203.468
Status Not validated
Chromosome1
Chromosomal Location83041524-83042480 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) AGCCACAGCCACCACAGCCACAGCCACCAC to AGCCACAGCCACCACCGCCACAGCCACCACAGCCACAGCCACCAC at 83042258 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045560] [ENSMUST00000164473] [ENSMUST00000188323] [ENSMUST00000222567]
Predicted Effect probably benign
Transcript: ENSMUST00000045560
SMART Domains Protein: ENSMUSP00000041683
Gene: ENSMUSG00000038496

DomainStartEndE-ValueType
Pfam:Folate_carrier 11 435 1.4e-178 PFAM
Pfam:MFS_1 16 416 1.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164473
SMART Domains Protein: ENSMUSP00000126646
Gene: ENSMUSG00000038496

DomainStartEndE-ValueType
Pfam:Folate_carrier 11 435 1.3e-178 PFAM
Pfam:MFS_1 16 416 1.9e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188323
Predicted Effect probably benign
Transcript: ENSMUST00000222567
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik GCTGTG GCTGTGCCTCCTGTG 1: 82,913,578 probably benign Het
A030005L19Rik TGTGGCTGC TGTGGCTGCCGTGGCTGC 1: 82,913,580 probably benign Het
Acap3 TGCATCCTGGGCTGC TGCATCCTGGGCTGCAGCATCCTGGGCTGC 4: 155,905,091 probably benign Het
Arid1b C CGGG 17: 4,995,598 probably benign Het
Blm CCTCCTCCTCCTCCTCCTCCTCCT CCTCCTCCTCCTACTCCTCCTCCTCCTCCTCCTCCT 7: 80,512,905 probably null Het
Boc GAC G 16: 44,496,433 probably null Het
Cacna1f GAG GAGAAG X: 7,620,060 probably benign Het
Cacna1f GAG GAGAAG X: 7,620,063 probably benign Het
Catsper2 ATCGCTTTCCTCGTTTTCG ATCG 2: 121,397,726 probably benign Het
Dbr1 GAGGAG GAGGAGTAGGAG 9: 99,583,697 probably null Het
E4f1 CGC CGCGGC 17: 24,455,190 probably benign Het
Eps8 TCGCTC TCGCTCGCTC 6: 137,517,063 probably benign Het
Ermn AACT AACTACT 2: 58,048,066 probably benign Het
Fsip2 TAGATGTGAAACCCTTAGAGGTAAGATGTGAAACTCTTAGAGGTAAGA TAGATGTGAAACTCTTAGAGGTAAGA 2: 82,994,008 probably null Het
Gab3 CTTCTT CTTATTCTT X: 75,000,000 probably null Het
Gab3 TCT TCTGCT X: 75,000,017 probably benign Het
Gabre CTC CTCTGGGTC X: 72,270,763 probably benign Het
Gm7579 GGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGATGCAAGGGAGGCTGTGGCTCCTGTGGGGG GGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGATGCAAGGGAGGCTGTGGCTCCTGTGGGGG 7: 142,212,045 probably benign Het
Gm8369 TG TGGGTGAG 19: 11,511,773 probably null Het
Hsdl2 CAGCTGCAG CAGCTGCAGCAGCAGCCATAGCTGCAG 4: 59,610,650 probably null Het
Iqcf4 TTTTCCTTTT TTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCGTTTCCTTTT 9: 106,570,614 probably benign Het
Kmt2e TTT TTTTATT 5: 23,478,509 probably benign Het
Kri1 CTCCTCCT C 9: 21,281,071 probably null Het
Lce1m GTTGCTGCCACTG GTTGCTGCCACTGTTGCTGCCACTG 3: 93,018,131 probably benign Het
Lor CGCCGCCT C 3: 92,081,899 probably null Het
Luzp1 A AGGTGGCCTCTTCAGG 4: 136,543,196 probably benign Het
Lypd8 CCAACA CCAACAGGTCCCTCGCCTCTGTTACCCCACAAATAAACAACA 11: 58,390,239 probably benign Het
Mn1 CAG CAGGAG 5: 111,419,711 probably benign Het
Nefh GGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGACTTGGCCTCACCTGTGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,012 probably benign Het
Nefh GGGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGGACTTGGCCTCACCTTGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,029 probably benign Het
Nf2 AAAAG A 11: 4,829,936 probably null Het
Nusap1 AGAT AGATCCACGTTAGCAGTGAGGAGCAAGCTGCGAT 2: 119,627,578 probably benign Het
Nusap1 CAGTGAGGAGCAAGCTGAGA CAGTGAGGAGCAAGCTGAGATACACGTTAGTAGTGAGGAGCAAGCTGAGA 2: 119,627,591 probably benign Het
Phf20 CCCCCC CCCCCCGCCCCC 2: 156,304,623 probably benign Het
Ppp1r8 TCTCTCTCAC TC 4: 132,830,615 probably benign Het
Prr5l GCCTC G 2: 101,797,573 probably null Het
Rbm12 CGGGACCGGGCATTGCGGGACCGGGCATTGCGGG CGG 2: 156,096,130 probably null Het
Rpgrip1 GA GAGTA 14: 52,149,398 probably null Het
Tanc1 GTGAGCAGAAACCAGCATTTAGAGGGAACCGGTCCCTTCACTGCAGGAA G 2: 59,843,269 probably benign Het
Tfeb GCA GCATCA 17: 47,786,097 probably benign Het
Tgoln1 T TTGTCTTGTCAGAATCACCTCCTGG 6: 72,616,036 probably benign Het
Thegl AGCGATCCTCCCCAGTCCCGCAAGGCC AGCGATCCTCCCCAGTCCCGCAAGGCCCGCGATCCTCCCCAGTCCCGCAAGGCC 5: 77,016,401 probably benign Het
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Trappc9 GCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT GCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT 15: 72,801,290 probably benign Het
Triobp CAGGACT CAGGACTGCCTGTGCCCAACGGAACAACCCAAGGACT 15: 78,967,039 probably benign Het
Zfhx3 AACAGCAGC AACAGCAGCTACAGCAGC 8: 108,956,096 probably benign Het
Zfp933 TT TTTGCCT 4: 147,825,731 probably null Het
Other mutations in Krtap28-10
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4737:Krtap28-10 UTSW 1 83042123 unclassified probably benign
RF001:Krtap28-10 UTSW 1 83042255 unclassified probably benign
RF001:Krtap28-10 UTSW 1 83042280 unclassified probably benign
RF001:Krtap28-10 UTSW 1 83042282 unclassified probably benign
RF008:Krtap28-10 UTSW 1 83042128 unclassified probably benign
RF008:Krtap28-10 UTSW 1 83042135 unclassified probably benign
RF008:Krtap28-10 UTSW 1 83042253 unclassified probably benign
RF008:Krtap28-10 UTSW 1 83042279 unclassified probably benign
RF012:Krtap28-10 UTSW 1 83042136 unclassified probably benign
RF013:Krtap28-10 UTSW 1 83042135 unclassified probably benign
RF013:Krtap28-10 UTSW 1 83042274 unclassified probably benign
RF014:Krtap28-10 UTSW 1 83042251 unclassified probably benign
RF016:Krtap28-10 UTSW 1 83042123 unclassified probably benign
RF017:Krtap28-10 UTSW 1 83042138 unclassified probably benign
RF017:Krtap28-10 UTSW 1 83042266 unclassified probably benign
RF018:Krtap28-10 UTSW 1 83042253 unclassified probably benign
RF019:Krtap28-10 UTSW 1 83042269 unclassified probably benign
RF023:Krtap28-10 UTSW 1 83042146 nonsense probably null
RF023:Krtap28-10 UTSW 1 83042286 unclassified probably benign
RF024:Krtap28-10 UTSW 1 83042123 unclassified probably benign
RF024:Krtap28-10 UTSW 1 83042252 unclassified probably benign
RF025:Krtap28-10 UTSW 1 83042258 unclassified probably benign
RF026:Krtap28-10 UTSW 1 83042126 unclassified probably benign
RF027:Krtap28-10 UTSW 1 83042285 unclassified probably benign
RF029:Krtap28-10 UTSW 1 83042270 unclassified probably benign
RF032:Krtap28-10 UTSW 1 83042258 unclassified probably benign
RF034:Krtap28-10 UTSW 1 83042282 unclassified probably benign
RF035:Krtap28-10 UTSW 1 83042146 unclassified probably benign
RF035:Krtap28-10 UTSW 1 83042281 unclassified probably benign
RF037:Krtap28-10 UTSW 1 83042145 unclassified probably benign
RF037:Krtap28-10 UTSW 1 83042286 unclassified probably benign
RF038:Krtap28-10 UTSW 1 83042128 unclassified probably benign
RF038:Krtap28-10 UTSW 1 83042257 unclassified probably benign
RF042:Krtap28-10 UTSW 1 83042125 unclassified probably benign
RF044:Krtap28-10 UTSW 1 83042131 unclassified probably benign
RF045:Krtap28-10 UTSW 1 83042143 unclassified probably benign
RF045:Krtap28-10 UTSW 1 83042261 unclassified probably benign
RF049:Krtap28-10 UTSW 1 83042138 unclassified probably benign
RF049:Krtap28-10 UTSW 1 83042285 unclassified probably benign
RF053:Krtap28-10 UTSW 1 83042278 unclassified probably benign
RF055:Krtap28-10 UTSW 1 83042130 unclassified probably benign
RF055:Krtap28-10 UTSW 1 83042262 unclassified probably benign
RF055:Krtap28-10 UTSW 1 83042270 unclassified probably benign
RF058:Krtap28-10 UTSW 1 83042262 unclassified probably benign
RF059:Krtap28-10 UTSW 1 83042275 unclassified probably benign
RF059:Krtap28-10 UTSW 1 83042290 unclassified probably benign
RF061:Krtap28-10 UTSW 1 83042281 unclassified probably benign
RF064:Krtap28-10 UTSW 1 83042131 unclassified probably benign
Z1177:Krtap28-10 UTSW 1 83042159 missense unknown
Predicted Primers PCR Primer
(F):5'- TCGTAGCTTAGAACCAGAGCC -3'
(R):5'- TCCTCTCTACTGACAACATGGG -3'

Sequencing Primer
(F):5'- GCTAGCAGCAGCACTTCTTG -3'
(R):5'- AACATGGGTTGTTGTGGCTG -3'
Posted On2019-12-04