Incidental Mutation 'RF028:Tanc1'
ID604211
Institutional Source Beutler Lab
Gene Symbol Tanc1
Ensembl Gene ENSMUSG00000035168
Gene Nametetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1
Synonyms1200003E16Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF028 (G1)
Quality Score214.458
Status Not validated
Chromosome2
Chromosomal Location59612042-59846149 bp(+) (GRCm38)
Type of Mutationsmall deletion (16 aa in frame mutation)
DNA Base Change (assembly) GTGAGCAGAAACCAGCATTTAGAGGGAACCGGTCCCTTCACTGCAGGAA to G at 59843269 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037526] [ENSMUST00000112568] [ENSMUST00000139863]
Predicted Effect probably benign
Transcript: ENSMUST00000037526
SMART Domains Protein: ENSMUSP00000036003
Gene: ENSMUSG00000035168

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
low complexity region 60 78 N/A INTRINSIC
low complexity region 171 191 N/A INTRINSIC
low complexity region 229 240 N/A INTRINSIC
low complexity region 439 451 N/A INTRINSIC
low complexity region 455 475 N/A INTRINSIC
ANK 893 925 1.06e3 SMART
ANK 929 960 2.43e3 SMART
ANK 964 993 1.12e-3 SMART
Blast:ANK 997 1028 7e-12 BLAST
ANK 1037 1066 1.78e3 SMART
ANK 1075 1104 2.34e-1 SMART
ANK 1108 1137 3.71e-4 SMART
ANK 1141 1170 1.51e-4 SMART
ANK 1174 1203 4.89e-4 SMART
ANK 1207 1236 3.01e-4 SMART
ANK 1240 1269 1.99e2 SMART
TPR 1286 1319 7.49e1 SMART
TPR 1333 1366 2.35e-1 SMART
TPR 1367 1400 6.29e-2 SMART
low complexity region 1416 1432 N/A INTRINSIC
low complexity region 1454 1483 N/A INTRINSIC
low complexity region 1656 1686 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112568
SMART Domains Protein: ENSMUSP00000108187
Gene: ENSMUSG00000035168

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
low complexity region 60 78 N/A INTRINSIC
low complexity region 171 191 N/A INTRINSIC
low complexity region 229 240 N/A INTRINSIC
low complexity region 432 444 N/A INTRINSIC
low complexity region 448 468 N/A INTRINSIC
ANK 886 918 1.06e3 SMART
ANK 922 953 2.43e3 SMART
ANK 957 986 1.12e-3 SMART
Blast:ANK 990 1021 7e-12 BLAST
ANK 1030 1059 1.78e3 SMART
ANK 1068 1097 2.34e-1 SMART
ANK 1101 1130 3.71e-4 SMART
ANK 1134 1163 1.51e-4 SMART
ANK 1167 1196 4.89e-4 SMART
ANK 1200 1229 3.01e-4 SMART
ANK 1233 1262 1.99e2 SMART
TPR 1279 1312 7.49e1 SMART
TPR 1326 1359 2.35e-1 SMART
TPR 1360 1393 6.29e-2 SMART
low complexity region 1409 1425 N/A INTRINSIC
low complexity region 1447 1476 N/A INTRINSIC
low complexity region 1649 1679 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139863
SMART Domains Protein: ENSMUSP00000123345
Gene: ENSMUSG00000035168

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
low complexity region 60 78 N/A INTRINSIC
low complexity region 171 191 N/A INTRINSIC
low complexity region 229 240 N/A INTRINSIC
low complexity region 439 451 N/A INTRINSIC
low complexity region 455 475 N/A INTRINSIC
ANK 893 925 1.06e3 SMART
ANK 929 960 2.43e3 SMART
ANK 964 993 1.12e-3 SMART
Blast:ANK 997 1028 7e-12 BLAST
ANK 1037 1066 1.78e3 SMART
ANK 1075 1104 2.34e-1 SMART
ANK 1108 1137 3.71e-4 SMART
ANK 1141 1170 1.51e-4 SMART
ANK 1174 1203 4.89e-4 SMART
ANK 1207 1236 3.01e-4 SMART
ANK 1240 1269 1.99e2 SMART
TPR 1286 1319 7.49e1 SMART
TPR 1333 1366 2.35e-1 SMART
TPR 1367 1400 6.29e-2 SMART
low complexity region 1416 1432 N/A INTRINSIC
low complexity region 1454 1483 N/A INTRINSIC
low complexity region 1656 1686 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap vector exhibit decreased spine density in the CA3 region and impaired spatial memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik GCTGTG GCTGTGCCTCCTGTG 1: 82,913,578 probably benign Het
A030005L19Rik TGTGGCTGC TGTGGCTGCCGTGGCTGC 1: 82,913,580 probably benign Het
Acap3 TGCATCCTGGGCTGC TGCATCCTGGGCTGCAGCATCCTGGGCTGC 4: 155,905,091 probably benign Het
Arid1b C CGGG 17: 4,995,598 probably benign Het
Blm CCTCCTCCTCCTCCTCCTCCTCCT CCTCCTCCTCCTACTCCTCCTCCTCCTCCTCCTCCT 7: 80,512,905 probably null Het
Boc GAC G 16: 44,496,433 probably null Het
Cacna1f GAG GAGAAG X: 7,620,060 probably benign Het
Cacna1f GAG GAGAAG X: 7,620,063 probably benign Het
Catsper2 ATCGCTTTCCTCGTTTTCG ATCG 2: 121,397,726 probably benign Het
Dbr1 GAGGAG GAGGAGTAGGAG 9: 99,583,697 probably null Het
E4f1 CGC CGCGGC 17: 24,455,190 probably benign Het
Eps8 TCGCTC TCGCTCGCTC 6: 137,517,063 probably benign Het
Ermn AACT AACTACT 2: 58,048,066 probably benign Het
Fsip2 TAGATGTGAAACCCTTAGAGGTAAGATGTGAAACTCTTAGAGGTAAGA TAGATGTGAAACTCTTAGAGGTAAGA 2: 82,994,008 probably null Het
Gab3 CTTCTT CTTATTCTT X: 75,000,000 probably null Het
Gab3 TCT TCTGCT X: 75,000,017 probably benign Het
Gabre CTC CTCTGGGTC X: 72,270,763 probably benign Het
Gm7579 GGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGATGCAAGGGAGGCTGTGGCTCCTGTGGGGG GGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGATGCAAGGGAGGCTGTGGCTCCTGTGGGGG 7: 142,212,045 probably benign Het
Gm8369 TG TGGGTGAG 19: 11,511,773 probably null Het
Hsdl2 CAGCTGCAG CAGCTGCAGCAGCAGCCATAGCTGCAG 4: 59,610,650 probably null Het
Iqcf4 TTTTCCTTTT TTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCGTTTCCTTTT 9: 106,570,614 probably benign Het
Kmt2e TTT TTTTATT 5: 23,478,509 probably benign Het
Kri1 CTCCTCCT C 9: 21,281,071 probably null Het
Krtap28-10 AGCCACAGCCACCACAGCCACAGCCACCAC AGCCACAGCCACCACCGCCACAGCCACCACAGCCACAGCCACCAC 1: 83,042,258 probably benign Het
Lce1m GTTGCTGCCACTG GTTGCTGCCACTGTTGCTGCCACTG 3: 93,018,131 probably benign Het
Lor CGCCGCCT C 3: 92,081,899 probably null Het
Luzp1 A AGGTGGCCTCTTCAGG 4: 136,543,196 probably benign Het
Lypd8 CCAACA CCAACAGGTCCCTCGCCTCTGTTACCCCACAAATAAACAACA 11: 58,390,239 probably benign Het
Mn1 CAG CAGGAG 5: 111,419,711 probably benign Het
Nefh GGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGACTTGGCCTCACCTGTGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,012 probably benign Het
Nefh GGGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGGACTTGGCCTCACCTTGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,029 probably benign Het
Nf2 AAAAG A 11: 4,829,936 probably null Het
Nusap1 AGAT AGATCCACGTTAGCAGTGAGGAGCAAGCTGCGAT 2: 119,627,578 probably benign Het
Nusap1 CAGTGAGGAGCAAGCTGAGA CAGTGAGGAGCAAGCTGAGATACACGTTAGTAGTGAGGAGCAAGCTGAGA 2: 119,627,591 probably benign Het
Phf20 CCCCCC CCCCCCGCCCCC 2: 156,304,623 probably benign Het
Ppp1r8 TCTCTCTCAC TC 4: 132,830,615 probably benign Het
Prr5l GCCTC G 2: 101,797,573 probably null Het
Rbm12 CGGGACCGGGCATTGCGGGACCGGGCATTGCGGG CGG 2: 156,096,130 probably null Het
Rpgrip1 GA GAGTA 14: 52,149,398 probably null Het
Tfeb GCA GCATCA 17: 47,786,097 probably benign Het
Tgoln1 T TTGTCTTGTCAGAATCACCTCCTGG 6: 72,616,036 probably benign Het
Thegl AGCGATCCTCCCCAGTCCCGCAAGGCC AGCGATCCTCCCCAGTCCCGCAAGGCCCGCGATCCTCCCCAGTCCCGCAAGGCC 5: 77,016,401 probably benign Het
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Trappc9 GCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT GCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT 15: 72,801,290 probably benign Het
Triobp CAGGACT CAGGACTGCCTGTGCCCAACGGAACAACCCAAGGACT 15: 78,967,039 probably benign Het
Zfhx3 AACAGCAGC AACAGCAGCTACAGCAGC 8: 108,956,096 probably benign Het
Zfp933 TT TTTGCCT 4: 147,825,731 probably null Het
Other mutations in Tanc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Tanc1 APN 2 59790841 missense possibly damaging 0.84
IGL00484:Tanc1 APN 2 59793176 missense probably benign 0.00
IGL00688:Tanc1 APN 2 59815391 missense probably damaging 1.00
IGL00765:Tanc1 APN 2 59806301 missense probably benign 0.15
IGL01576:Tanc1 APN 2 59797735 missense probably damaging 1.00
IGL01590:Tanc1 APN 2 59785473 missense probably benign
IGL02016:Tanc1 APN 2 59843590 missense probably benign 0.00
IGL02373:Tanc1 APN 2 59796028 critical splice donor site probably null
IGL02539:Tanc1 APN 2 59833258 missense probably damaging 1.00
IGL02540:Tanc1 APN 2 59833258 missense probably damaging 1.00
IGL02541:Tanc1 APN 2 59833258 missense probably damaging 1.00
IGL02543:Tanc1 APN 2 59833258 missense probably damaging 1.00
IGL02559:Tanc1 APN 2 59724654 splice site probably benign
IGL02626:Tanc1 APN 2 59799872 missense probably damaging 1.00
IGL02669:Tanc1 APN 2 59799986 missense probably damaging 1.00
IGL02902:Tanc1 APN 2 59793087 splice site probably benign
Oreja UTSW 2 59791804 synonymous silent
R0178:Tanc1 UTSW 2 59835447 nonsense probably null
R0347:Tanc1 UTSW 2 59842991 missense probably benign
R0570:Tanc1 UTSW 2 59796038 splice site probably benign
R0660:Tanc1 UTSW 2 59843884 nonsense probably null
R0664:Tanc1 UTSW 2 59843884 nonsense probably null
R0898:Tanc1 UTSW 2 59790788 missense probably damaging 1.00
R1333:Tanc1 UTSW 2 59843491 missense probably benign
R1575:Tanc1 UTSW 2 59791651 missense probably damaging 1.00
R1608:Tanc1 UTSW 2 59797694 missense possibly damaging 0.80
R1616:Tanc1 UTSW 2 59785387 missense probably damaging 1.00
R1703:Tanc1 UTSW 2 59843021 missense probably benign 0.02
R1727:Tanc1 UTSW 2 59790809 missense probably damaging 1.00
R1809:Tanc1 UTSW 2 59800097 missense probably damaging 1.00
R1812:Tanc1 UTSW 2 59791679 missense probably damaging 1.00
R1925:Tanc1 UTSW 2 59724751 missense possibly damaging 0.48
R1951:Tanc1 UTSW 2 59791812 missense possibly damaging 0.92
R2174:Tanc1 UTSW 2 59843833 missense possibly damaging 0.72
R2228:Tanc1 UTSW 2 59724724 missense probably benign 0.04
R2267:Tanc1 UTSW 2 59837219 critical splice donor site probably null
R4191:Tanc1 UTSW 2 59839013 missense probably damaging 1.00
R4476:Tanc1 UTSW 2 59841996 splice site probably null
R4632:Tanc1 UTSW 2 59795835 missense probably damaging 1.00
R4825:Tanc1 UTSW 2 59699422 missense probably damaging 1.00
R4982:Tanc1 UTSW 2 59799943 missense probably damaging 1.00
R5338:Tanc1 UTSW 2 59795834 missense probably damaging 1.00
R5657:Tanc1 UTSW 2 59834707 splice site probably null
R5672:Tanc1 UTSW 2 59772353 missense possibly damaging 0.81
R5703:Tanc1 UTSW 2 59795997 missense probably damaging 0.98
R5707:Tanc1 UTSW 2 59758530 missense probably benign
R5778:Tanc1 UTSW 2 59699347 critical splice acceptor site probably null
R5795:Tanc1 UTSW 2 59807582 missense possibly damaging 0.62
R5831:Tanc1 UTSW 2 59785341 missense possibly damaging 0.89
R5849:Tanc1 UTSW 2 59799904 missense probably benign 0.00
R5912:Tanc1 UTSW 2 59791686 missense possibly damaging 0.92
R5944:Tanc1 UTSW 2 59837220 critical splice donor site probably null
R6057:Tanc1 UTSW 2 59817493 missense possibly damaging 0.46
R6142:Tanc1 UTSW 2 59833222 nonsense probably null
R6179:Tanc1 UTSW 2 59842976 missense probably benign 0.42
R6185:Tanc1 UTSW 2 59791585 splice site probably null
R6192:Tanc1 UTSW 2 59838961 splice site probably null
R6196:Tanc1 UTSW 2 59844022 missense possibly damaging 0.94
R6197:Tanc1 UTSW 2 59844022 missense possibly damaging 0.94
R6230:Tanc1 UTSW 2 59842031 missense probably damaging 1.00
R6275:Tanc1 UTSW 2 59843510 missense probably benign 0.22
R6415:Tanc1 UTSW 2 59837114 missense probably benign 0.02
R6480:Tanc1 UTSW 2 59807642 missense probably damaging 1.00
R6578:Tanc1 UTSW 2 59795954 missense probably damaging 1.00
R6786:Tanc1 UTSW 2 59791806 missense probably benign 0.00
R7006:Tanc1 UTSW 2 59795844 missense probably damaging 1.00
R7133:Tanc1 UTSW 2 59797609 missense probably benign 0.16
R7381:Tanc1 UTSW 2 59785326 missense probably damaging 1.00
R7422:Tanc1 UTSW 2 59806344 missense probably benign 0.02
R8392:Tanc1 UTSW 2 59806307 missense probably damaging 0.99
RF049:Tanc1 UTSW 2 59843269 small deletion probably benign
X0063:Tanc1 UTSW 2 59843980 nonsense probably null
X0064:Tanc1 UTSW 2 59844112 missense probably damaging 1.00
Z1176:Tanc1 UTSW 2 59772529 missense possibly damaging 0.93
Z1177:Tanc1 UTSW 2 59790887 missense probably benign
Z1177:Tanc1 UTSW 2 59791830 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGGCTTGGTTATGCAGC -3'
(R):5'- ATCTTTATGCTGCTCGATGGAG -3'

Sequencing Primer
(F):5'- TTGGTTATGCAGCCTACCAAACAG -3'
(R):5'- TGCCGCACATCGCTACAG -3'
Posted On2019-12-04