Incidental Mutation 'RF028:Prr5l'
ID604213
Institutional Source Beutler Lab
Gene Symbol Prr5l
Ensembl Gene ENSMUSG00000032841
Gene Nameproline rich 5 like
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #RF028 (G1)
Quality Score214.458
Status Not validated
Chromosome2
Chromosomal Location101714285-101883027 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GCCTC to G at 101797573 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000043845] [ENSMUST00000124802] [ENSMUST00000125985] [ENSMUST00000144549] [ENSMUST00000154525] [ENSMUST00000163762] [ENSMUST00000171088]
Predicted Effect probably benign
Transcript: ENSMUST00000043845
SMART Domains Protein: ENSMUSP00000042167
Gene: ENSMUSG00000032841

DomainStartEndE-ValueType
low complexity region 18 30 N/A INTRINSIC
Pfam:HbrB 47 152 5.4e-15 PFAM
low complexity region 164 178 N/A INTRINSIC
low complexity region 323 332 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124802
SMART Domains Protein: ENSMUSP00000118502
Gene: ENSMUSG00000032841

DomainStartEndE-ValueType
low complexity region 18 30 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125985
SMART Domains Protein: ENSMUSP00000122996
Gene: ENSMUSG00000032841

DomainStartEndE-ValueType
low complexity region 18 30 N/A INTRINSIC
Pfam:HbrB 45 128 3e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000141814
SMART Domains Protein: ENSMUSP00000118537
Gene: ENSMUSG00000032841

DomainStartEndE-ValueType
low complexity region 20 32 N/A INTRINSIC
low complexity region 56 69 N/A INTRINSIC
low complexity region 93 107 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144549
Predicted Effect probably benign
Transcript: ENSMUST00000154525
SMART Domains Protein: ENSMUSP00000120192
Gene: ENSMUSG00000032841

DomainStartEndE-ValueType
low complexity region 18 30 N/A INTRINSIC
Pfam:HbrB 45 95 2.8e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163762
SMART Domains Protein: ENSMUSP00000127530
Gene: ENSMUSG00000032841

DomainStartEndE-ValueType
low complexity region 18 30 N/A INTRINSIC
Pfam:HbrB 45 177 2.8e-36 PFAM
low complexity region 323 332 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171088
SMART Domains Protein: ENSMUSP00000130152
Gene: ENSMUSG00000032841

DomainStartEndE-ValueType
low complexity region 18 30 N/A INTRINSIC
Pfam:HbrB 45 177 2.8e-36 PFAM
low complexity region 323 332 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik GCTGTG GCTGTGCCTCCTGTG 1: 82,913,578 probably benign Het
A030005L19Rik TGTGGCTGC TGTGGCTGCCGTGGCTGC 1: 82,913,580 probably benign Het
Acap3 TGCATCCTGGGCTGC TGCATCCTGGGCTGCAGCATCCTGGGCTGC 4: 155,905,091 probably benign Het
Arid1b C CGGG 17: 4,995,598 probably benign Het
Blm CCTCCTCCTCCTCCTCCTCCTCCT CCTCCTCCTCCTACTCCTCCTCCTCCTCCTCCTCCT 7: 80,512,905 probably null Het
Boc GAC G 16: 44,496,433 probably null Het
Cacna1f GAG GAGAAG X: 7,620,060 probably benign Het
Cacna1f GAG GAGAAG X: 7,620,063 probably benign Het
Catsper2 ATCGCTTTCCTCGTTTTCG ATCG 2: 121,397,726 probably benign Het
Dbr1 GAGGAG GAGGAGTAGGAG 9: 99,583,697 probably null Het
E4f1 CGC CGCGGC 17: 24,455,190 probably benign Het
Eps8 TCGCTC TCGCTCGCTC 6: 137,517,063 probably benign Het
Ermn AACT AACTACT 2: 58,048,066 probably benign Het
Fsip2 TAGATGTGAAACCCTTAGAGGTAAGATGTGAAACTCTTAGAGGTAAGA TAGATGTGAAACTCTTAGAGGTAAGA 2: 82,994,008 probably null Het
Gab3 CTTCTT CTTATTCTT X: 75,000,000 probably null Het
Gab3 TCT TCTGCT X: 75,000,017 probably benign Het
Gabre CTC CTCTGGGTC X: 72,270,763 probably benign Het
Gm7579 GGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGATGCAAGGGAGGCTGTGGCTCCTGTGGGGG GGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGATGCAAGGGAGGCTGTGGCTCCTGTGGGGG 7: 142,212,045 probably benign Het
Gm8369 TG TGGGTGAG 19: 11,511,773 probably null Het
Hsdl2 CAGCTGCAG CAGCTGCAGCAGCAGCCATAGCTGCAG 4: 59,610,650 probably null Het
Iqcf4 TTTTCCTTTT TTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCGTTTCCTTTT 9: 106,570,614 probably benign Het
Kmt2e TTT TTTTATT 5: 23,478,509 probably benign Het
Kri1 CTCCTCCT C 9: 21,281,071 probably null Het
Krtap28-10 AGCCACAGCCACCACAGCCACAGCCACCAC AGCCACAGCCACCACCGCCACAGCCACCACAGCCACAGCCACCAC 1: 83,042,258 probably benign Het
Lce1m GTTGCTGCCACTG GTTGCTGCCACTGTTGCTGCCACTG 3: 93,018,131 probably benign Het
Lor CGCCGCCT C 3: 92,081,899 probably null Het
Luzp1 A AGGTGGCCTCTTCAGG 4: 136,543,196 probably benign Het
Lypd8 CCAACA CCAACAGGTCCCTCGCCTCTGTTACCCCACAAATAAACAACA 11: 58,390,239 probably benign Het
Mn1 CAG CAGGAG 5: 111,419,711 probably benign Het
Nefh GGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGACTTGGCCTCACCTGTGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,012 probably benign Het
Nefh GGGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGGACTTGGCCTCACCTTGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,029 probably benign Het
Nf2 AAAAG A 11: 4,829,936 probably null Het
Nusap1 AGAT AGATCCACGTTAGCAGTGAGGAGCAAGCTGCGAT 2: 119,627,578 probably benign Het
Nusap1 CAGTGAGGAGCAAGCTGAGA CAGTGAGGAGCAAGCTGAGATACACGTTAGTAGTGAGGAGCAAGCTGAGA 2: 119,627,591 probably benign Het
Phf20 CCCCCC CCCCCCGCCCCC 2: 156,304,623 probably benign Het
Ppp1r8 TCTCTCTCAC TC 4: 132,830,615 probably benign Het
Rbm12 CGGGACCGGGCATTGCGGGACCGGGCATTGCGGG CGG 2: 156,096,130 probably null Het
Rpgrip1 GA GAGTA 14: 52,149,398 probably null Het
Tanc1 GTGAGCAGAAACCAGCATTTAGAGGGAACCGGTCCCTTCACTGCAGGAA G 2: 59,843,269 probably benign Het
Tfeb GCA GCATCA 17: 47,786,097 probably benign Het
Tgoln1 T TTGTCTTGTCAGAATCACCTCCTGG 6: 72,616,036 probably benign Het
Thegl AGCGATCCTCCCCAGTCCCGCAAGGCC AGCGATCCTCCCCAGTCCCGCAAGGCCCGCGATCCTCCCCAGTCCCGCAAGGCC 5: 77,016,401 probably benign Het
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Trappc9 GCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT GCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT 15: 72,801,290 probably benign Het
Triobp CAGGACT CAGGACTGCCTGTGCCCAACGGAACAACCCAAGGACT 15: 78,967,039 probably benign Het
Zfhx3 AACAGCAGC AACAGCAGCTACAGCAGC 8: 108,956,096 probably benign Het
Zfp933 TT TTTGCCT 4: 147,825,731 probably null Het
Other mutations in Prr5l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02183:Prr5l APN 2 101772120 splice site probably benign
IGL02946:Prr5l APN 2 101772184 splice site probably null
PIT4618001:Prr5l UTSW 2 101758530 missense probably damaging 0.99
R0652:Prr5l UTSW 2 101772290 missense possibly damaging 0.94
R0722:Prr5l UTSW 2 101717474 splice site probably benign
R0882:Prr5l UTSW 2 101758541 missense possibly damaging 0.81
R1962:Prr5l UTSW 2 101758509 critical splice donor site probably null
R3013:Prr5l UTSW 2 101734705 missense probably damaging 1.00
R4564:Prr5l UTSW 2 101746749 missense probably damaging 1.00
R4604:Prr5l UTSW 2 101729448 missense probably benign 0.44
R4902:Prr5l UTSW 2 101797682 utr 5 prime probably benign
R5338:Prr5l UTSW 2 101717107 missense probably benign 0.00
R6279:Prr5l UTSW 2 101717420 nonsense probably null
R6792:Prr5l UTSW 2 101717424 missense probably benign 0.00
R7214:Prr5l UTSW 2 101729432 missense probably benign
R7299:Prr5l UTSW 2 101717286 missense probably damaging 1.00
R7301:Prr5l UTSW 2 101717286 missense probably damaging 1.00
R7672:Prr5l UTSW 2 101734738 missense probably damaging 1.00
R7702:Prr5l UTSW 2 101717097 missense probably benign 0.04
R8086:Prr5l UTSW 2 101741364 missense probably benign 0.00
R8116:Prr5l UTSW 2 101797574 frame shift probably null
R8297:Prr5l UTSW 2 101741285 critical splice donor site probably null
RF033:Prr5l UTSW 2 101797573 frame shift probably null
RF039:Prr5l UTSW 2 101797573 frame shift probably null
X0018:Prr5l UTSW 2 101717259 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCAGAATGATGACTTCAGGCC -3'
(R):5'- GAGAAACCACAGCGATGTGC -3'

Sequencing Primer
(F):5'- ATGATGACTTCAGGCCCTCCAG -3'
(R):5'- CGATGTGCACCGGACAG -3'
Posted On2019-12-04