Incidental Mutation 'RF028:Lor'
ID 604219
Institutional Source Beutler Lab
Gene Symbol Lor
Ensembl Gene ENSMUSG00000043165
Gene Name loricrin
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock # RF028 (G1)
Quality Score 217.468
Status Not validated
Chromosome 3
Chromosomal Location 92080271-92083142 bp(-) (GRCm38)
Type of Mutation frame shift
DNA Base Change (assembly) CGCCGCCT to C at 92081899 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000052128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058150]
AlphaFold P18165
Predicted Effect probably null
Transcript: ENSMUST00000058150
SMART Domains Protein: ENSMUSP00000052128
Gene: ENSMUSG00000043165

Pfam:Loricrin 316 438 2.7e-11 PFAM
Pfam:Loricrin 426 486 1.4e-14 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene are runted at birth, have a translucent skin and skin skin barrier defect. The morphological skin phenotype disappears after 4-5 days. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik GCTGTG GCTGTGCCTCCTGTG 1: 82,913,578 probably benign Het
A030005L19Rik TGTGGCTGC TGTGGCTGCCGTGGCTGC 1: 82,913,580 probably benign Het
Arid1b C CGGG 17: 4,995,598 probably benign Het
Boc GAC G 16: 44,496,433 probably null Het
Cacna1f GAG GAGAAG X: 7,620,060 probably benign Het
Cacna1f GAG GAGAAG X: 7,620,063 probably benign Het
Catsper2 ATCGCTTTCCTCGTTTTCG ATCG 2: 121,397,726 probably benign Het
Dbr1 GAGGAG GAGGAGTAGGAG 9: 99,583,697 probably null Het
E4f1 CGC CGCGGC 17: 24,455,190 probably benign Het
Eps8 TCGCTC TCGCTCGCTC 6: 137,517,063 probably benign Het
Ermn AACT AACTACT 2: 58,048,066 probably benign Het
Gab3 CTTCTT CTTATTCTT X: 75,000,000 probably null Het
Gab3 TCT TCTGCT X: 75,000,017 probably benign Het
Gabre CTC CTCTGGGTC X: 72,270,763 probably benign Het
Gm8369 TG TGGGTGAG 19: 11,511,773 probably null Het
Kmt2e TTT TTTTATT 5: 23,478,509 probably benign Het
Kri1 CTCCTCCT C 9: 21,281,071 probably null Het
Luzp1 A AGGTGGCCTCTTCAGG 4: 136,543,196 probably benign Het
Mn1 CAG CAGGAG 5: 111,419,711 probably benign Het
Nf2 AAAAG A 11: 4,829,936 probably null Het
Nusap1 AGAT AGATCCACGTTAGCAGTGAGGAGCAAGCTGCGAT 2: 119,627,578 probably benign Het
Phf20 CCCCCC CCCCCCGCCCCC 2: 156,304,623 probably benign Het
Ppp1r8 TCTCTCTCAC TC 4: 132,830,615 probably benign Het
Prr5l GCCTC G 2: 101,797,573 probably null Het
Rpgrip1 GA GAGTA 14: 52,149,398 probably null Het
Tfeb GCA GCATCA 17: 47,786,097 probably benign Het
Tgoln1 T TTGTCTTGTCAGAATCACCTCCTGG 6: 72,616,036 probably benign Het
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Zfhx3 AACAGCAGC AACAGCAGCTACAGCAGC 8: 108,956,096 probably benign Het
Zfp933 TT TTTGCCT 4: 147,825,731 probably null Het
Other mutations in Lor
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4589:Lor UTSW 3 92081894 frame shift probably null
R2932:Lor UTSW 3 92081878 small deletion probably benign
R4677:Lor UTSW 3 92081743 missense unknown
R5454:Lor UTSW 3 92081482 missense unknown
R5851:Lor UTSW 3 92080539 missense unknown
R6267:Lor UTSW 3 92081812 nonsense probably null
R7219:Lor UTSW 3 92081398 missense unknown
R7430:Lor UTSW 3 92081899 missense unknown
R7780:Lor UTSW 3 92081153 nonsense probably null
R8983:Lor UTSW 3 92081139 missense unknown
RF027:Lor UTSW 3 92081876 small deletion probably benign
RF031:Lor UTSW 3 92081876 small deletion probably benign
X0057:Lor UTSW 3 92081878 small deletion probably benign
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2019-12-04