Incidental Mutation 'RF028:Ppp1r8'
ID604222
Institutional Source Beutler Lab
Gene Symbol Ppp1r8
Ensembl Gene ENSMUSG00000028882
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 8
SynonymsNIPP1, 6330548N22Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF028 (G1)
Quality Score156.468
Status Not validated
Chromosome4
Chromosomal Location132826929-132843169 bp(-) (GRCm38)
Type of Mutationcritical splice donor site
DNA Base Change (assembly) TCTCTCTCAC to TC at 132830615 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000030702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030702] [ENSMUST00000105919]
PDB Structure
FHA domain of NIPP1 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000030702
SMART Domains Protein: ENSMUSP00000030702
Gene: ENSMUSG00000028882

DomainStartEndE-ValueType
FHA 48 101 3.6e-15 SMART
low complexity region 144 164 N/A INTRINSIC
PDB:3V4Y|H 165 216 7e-29 PDB
low complexity region 239 251 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105919
SMART Domains Protein: ENSMUSP00000101539
Gene: ENSMUSG00000028882

DomainStartEndE-ValueType
FHA 48 101 7.37e-13 SMART
low complexity region 144 164 N/A INTRINSIC
PDB:3V4Y|H 165 216 7e-29 PDB
low complexity region 238 250 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, through alternative splicing, encodes three different isoforms. Two of the protein isoforms encoded by this gene are specific inhibitors of type 1 serine/threonine protein phosphatases and can bind but not cleave RNA. The third protein isoform lacks the phosphatase inhibitory function but is a single-strand endoribonuclease comparable to RNase E of E. coli. This isoform requires magnesium for its function and cleaves specific sites in A+U-rich regions of RNA. [provided by RefSeq, Jul 2008]
PHENOTYPE: Embryos homozygous for knock-out allele exhibit severe growth retardation and impaired cell proliferation and die between embryonic days 6.5 and 7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik GCTGTG GCTGTGCCTCCTGTG 1: 82,913,578 probably benign Het
A030005L19Rik TGTGGCTGC TGTGGCTGCCGTGGCTGC 1: 82,913,580 probably benign Het
Acap3 TGCATCCTGGGCTGC TGCATCCTGGGCTGCAGCATCCTGGGCTGC 4: 155,905,091 probably benign Het
Arid1b C CGGG 17: 4,995,598 probably benign Het
Blm CCTCCTCCTCCTCCTCCTCCTCCT CCTCCTCCTCCTACTCCTCCTCCTCCTCCTCCTCCT 7: 80,512,905 probably null Het
Boc GAC G 16: 44,496,433 probably null Het
Cacna1f GAG GAGAAG X: 7,620,060 probably benign Het
Cacna1f GAG GAGAAG X: 7,620,063 probably benign Het
Catsper2 ATCGCTTTCCTCGTTTTCG ATCG 2: 121,397,726 probably benign Het
Dbr1 GAGGAG GAGGAGTAGGAG 9: 99,583,697 probably null Het
E4f1 CGC CGCGGC 17: 24,455,190 probably benign Het
Eps8 TCGCTC TCGCTCGCTC 6: 137,517,063 probably benign Het
Ermn AACT AACTACT 2: 58,048,066 probably benign Het
Fsip2 TAGATGTGAAACCCTTAGAGGTAAGATGTGAAACTCTTAGAGGTAAGA TAGATGTGAAACTCTTAGAGGTAAGA 2: 82,994,008 probably null Het
Gab3 CTTCTT CTTATTCTT X: 75,000,000 probably null Het
Gab3 TCT TCTGCT X: 75,000,017 probably benign Het
Gabre CTC CTCTGGGTC X: 72,270,763 probably benign Het
Gm7579 GGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGATGCAAGGGAGGCTGTGGCTCCTGTGGGGG GGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGATGCAAGGGAGGCTGTGGCTCCTGTGGGGG 7: 142,212,045 probably benign Het
Gm8369 TG TGGGTGAG 19: 11,511,773 probably null Het
Hsdl2 CAGCTGCAG CAGCTGCAGCAGCAGCCATAGCTGCAG 4: 59,610,650 probably null Het
Iqcf4 TTTTCCTTTT TTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCGTTTCCTTTT 9: 106,570,614 probably benign Het
Kmt2e TTT TTTTATT 5: 23,478,509 probably benign Het
Kri1 CTCCTCCT C 9: 21,281,071 probably null Het
Krtap28-10 AGCCACAGCCACCACAGCCACAGCCACCAC AGCCACAGCCACCACCGCCACAGCCACCACAGCCACAGCCACCAC 1: 83,042,258 probably benign Het
Lce1m GTTGCTGCCACTG GTTGCTGCCACTGTTGCTGCCACTG 3: 93,018,131 probably benign Het
Lor CGCCGCCT C 3: 92,081,899 probably null Het
Luzp1 A AGGTGGCCTCTTCAGG 4: 136,543,196 probably benign Het
Lypd8 CCAACA CCAACAGGTCCCTCGCCTCTGTTACCCCACAAATAAACAACA 11: 58,390,239 probably benign Het
Mn1 CAG CAGGAG 5: 111,419,711 probably benign Het
Nefh GGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGACTTGGCCTCACCTGTGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,012 probably benign Het
Nefh GGGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGGACTTGGCCTCACCTTGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,029 probably benign Het
Nf2 AAAAG A 11: 4,829,936 probably null Het
Nusap1 AGAT AGATCCACGTTAGCAGTGAGGAGCAAGCTGCGAT 2: 119,627,578 probably benign Het
Nusap1 CAGTGAGGAGCAAGCTGAGA CAGTGAGGAGCAAGCTGAGATACACGTTAGTAGTGAGGAGCAAGCTGAGA 2: 119,627,591 probably benign Het
Phf20 CCCCCC CCCCCCGCCCCC 2: 156,304,623 probably benign Het
Prr5l GCCTC G 2: 101,797,573 probably null Het
Rbm12 CGGGACCGGGCATTGCGGGACCGGGCATTGCGGG CGG 2: 156,096,130 probably null Het
Rpgrip1 GA GAGTA 14: 52,149,398 probably null Het
Tanc1 GTGAGCAGAAACCAGCATTTAGAGGGAACCGGTCCCTTCACTGCAGGAA G 2: 59,843,269 probably benign Het
Tfeb GCA GCATCA 17: 47,786,097 probably benign Het
Tgoln1 T TTGTCTTGTCAGAATCACCTCCTGG 6: 72,616,036 probably benign Het
Thegl AGCGATCCTCCCCAGTCCCGCAAGGCC AGCGATCCTCCCCAGTCCCGCAAGGCCCGCGATCCTCCCCAGTCCCGCAAGGCC 5: 77,016,401 probably benign Het
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Trappc9 GCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT GCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT 15: 72,801,290 probably benign Het
Triobp CAGGACT CAGGACTGCCTGTGCCCAACGGAACAACCCAAGGACT 15: 78,967,039 probably benign Het
Zfhx3 AACAGCAGC AACAGCAGCTACAGCAGC 8: 108,956,096 probably benign Het
Zfp933 TT TTTGCCT 4: 147,825,731 probably null Het
Other mutations in Ppp1r8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ppp1r8 APN 4 132834681 missense probably damaging 1.00
IGL00897:Ppp1r8 APN 4 132827902 missense probably damaging 0.96
IGL01669:Ppp1r8 APN 4 132828169 missense probably benign 0.02
IGL02663:Ppp1r8 APN 4 132833108 missense probably damaging 1.00
R0358:Ppp1r8 UTSW 4 132834728 missense probably damaging 0.99
R1458:Ppp1r8 UTSW 4 132840631 splice site probably benign
R1630:Ppp1r8 UTSW 4 132829437 missense probably benign 0.18
R7883:Ppp1r8 UTSW 4 132834715 missense probably damaging 0.97
R7966:Ppp1r8 UTSW 4 132834715 missense probably damaging 0.97
RF006:Ppp1r8 UTSW 4 132830617 critical splice donor site probably benign
Z1177:Ppp1r8 UTSW 4 132843091 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- ACTCTGTGTAACCATCTATCAGAGC -3'
(R):5'- GGTGTTTTCCCCATGAAACTCC -3'

Sequencing Primer
(F):5'- GTGTAACCATCTATCAGAGCACTTG -3'
(R):5'- AACTCCCTATGTATTAATTCTGGGC -3'
Posted On2019-12-04