Incidental Mutation 'RF028:Zfp933'
ID604224
Institutional Source Beutler Lab
Gene Symbol Zfp933
Ensembl Gene ENSMUSG00000059423
Gene Namezinc finger protein 933
Synonyms2810408P10Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #RF028 (G1)
Quality Score217.479
Status Not validated
Chromosome4
Chromosomal Location147822986-147848366 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TT to TTTGCCT at 147825731 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000101343 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105718] [ENSMUST00000135798]
Predicted Effect probably null
Transcript: ENSMUST00000105718
SMART Domains Protein: ENSMUSP00000101343
Gene: ENSMUSG00000059423

DomainStartEndE-ValueType
KRAB 4 66 9.49e-16 SMART
ZnF_C2H2 131 153 3.21e-4 SMART
ZnF_C2H2 159 181 5.21e-4 SMART
ZnF_C2H2 187 209 2.12e-4 SMART
ZnF_C2H2 215 237 7.26e-3 SMART
ZnF_C2H2 243 265 6.88e-4 SMART
ZnF_C2H2 271 293 1.13e-4 SMART
ZnF_C2H2 299 321 3.95e-4 SMART
ZnF_C2H2 327 349 1.56e-2 SMART
ZnF_C2H2 355 377 1.79e-2 SMART
ZnF_C2H2 383 405 4.24e-4 SMART
ZnF_C2H2 411 433 1.22e-4 SMART
ZnF_C2H2 439 461 4.79e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116174
Predicted Effect probably benign
Transcript: ENSMUST00000135798
SMART Domains Protein: ENSMUSP00000118300
Gene: ENSMUSG00000059423

DomainStartEndE-ValueType
Blast:KRAB 1 34 8e-18 BLAST
PDB:2I13|B 32 98 1e-12 PDB
SCOP:d1fgja_ 33 98 5e-13 SMART
Blast:PHD 44 98 6e-11 BLAST
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik GCTGTG GCTGTGCCTCCTGTG 1: 82,913,578 probably benign Het
A030005L19Rik TGTGGCTGC TGTGGCTGCCGTGGCTGC 1: 82,913,580 probably benign Het
Acap3 TGCATCCTGGGCTGC TGCATCCTGGGCTGCAGCATCCTGGGCTGC 4: 155,905,091 probably benign Het
Arid1b C CGGG 17: 4,995,598 probably benign Het
Blm CCTCCTCCTCCTCCTCCTCCTCCT CCTCCTCCTCCTACTCCTCCTCCTCCTCCTCCTCCT 7: 80,512,905 probably null Het
Boc GAC G 16: 44,496,433 probably null Het
Cacna1f GAG GAGAAG X: 7,620,060 probably benign Het
Cacna1f GAG GAGAAG X: 7,620,063 probably benign Het
Catsper2 ATCGCTTTCCTCGTTTTCG ATCG 2: 121,397,726 probably benign Het
Dbr1 GAGGAG GAGGAGTAGGAG 9: 99,583,697 probably null Het
E4f1 CGC CGCGGC 17: 24,455,190 probably benign Het
Eps8 TCGCTC TCGCTCGCTC 6: 137,517,063 probably benign Het
Ermn AACT AACTACT 2: 58,048,066 probably benign Het
Fsip2 TAGATGTGAAACCCTTAGAGGTAAGATGTGAAACTCTTAGAGGTAAGA TAGATGTGAAACTCTTAGAGGTAAGA 2: 82,994,008 probably null Het
Gab3 CTTCTT CTTATTCTT X: 75,000,000 probably null Het
Gab3 TCT TCTGCT X: 75,000,017 probably benign Het
Gabre CTC CTCTGGGTC X: 72,270,763 probably benign Het
Gm7579 GGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGATGCAAGGGAGGCTGTGGCTCCTGTGGGGG GGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGATGCAAGGGAGGCTGTGGCTCCTGTGGGGG 7: 142,212,045 probably benign Het
Gm8369 TG TGGGTGAG 19: 11,511,773 probably null Het
Hsdl2 CAGCTGCAG CAGCTGCAGCAGCAGCCATAGCTGCAG 4: 59,610,650 probably null Het
Iqcf4 TTTTCCTTTT TTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCGTTTCCTTTT 9: 106,570,614 probably benign Het
Kmt2e TTT TTTTATT 5: 23,478,509 probably benign Het
Kri1 CTCCTCCT C 9: 21,281,071 probably null Het
Krtap28-10 AGCCACAGCCACCACAGCCACAGCCACCAC AGCCACAGCCACCACCGCCACAGCCACCACAGCCACAGCCACCAC 1: 83,042,258 probably benign Het
Lce1m GTTGCTGCCACTG GTTGCTGCCACTGTTGCTGCCACTG 3: 93,018,131 probably benign Het
Lor CGCCGCCT C 3: 92,081,899 probably null Het
Luzp1 A AGGTGGCCTCTTCAGG 4: 136,543,196 probably benign Het
Lypd8 CCAACA CCAACAGGTCCCTCGCCTCTGTTACCCCACAAATAAACAACA 11: 58,390,239 probably benign Het
Mn1 CAG CAGGAG 5: 111,419,711 probably benign Het
Nefh GGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGACTTGGCCTCACCTGTGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,012 probably benign Het
Nefh GGGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGGACTTGGCCTCACCTTGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,029 probably benign Het
Nf2 AAAAG A 11: 4,829,936 probably null Het
Nusap1 AGAT AGATCCACGTTAGCAGTGAGGAGCAAGCTGCGAT 2: 119,627,578 probably benign Het
Nusap1 CAGTGAGGAGCAAGCTGAGA CAGTGAGGAGCAAGCTGAGATACACGTTAGTAGTGAGGAGCAAGCTGAGA 2: 119,627,591 probably benign Het
Phf20 CCCCCC CCCCCCGCCCCC 2: 156,304,623 probably benign Het
Ppp1r8 TCTCTCTCAC TC 4: 132,830,615 probably benign Het
Prr5l GCCTC G 2: 101,797,573 probably null Het
Rbm12 CGGGACCGGGCATTGCGGGACCGGGCATTGCGGG CGG 2: 156,096,130 probably null Het
Rpgrip1 GA GAGTA 14: 52,149,398 probably null Het
Tanc1 GTGAGCAGAAACCAGCATTTAGAGGGAACCGGTCCCTTCACTGCAGGAA G 2: 59,843,269 probably benign Het
Tfeb GCA GCATCA 17: 47,786,097 probably benign Het
Tgoln1 T TTGTCTTGTCAGAATCACCTCCTGG 6: 72,616,036 probably benign Het
Thegl AGCGATCCTCCCCAGTCCCGCAAGGCC AGCGATCCTCCCCAGTCCCGCAAGGCCCGCGATCCTCCCCAGTCCCGCAAGGCC 5: 77,016,401 probably benign Het
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Trappc9 GCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT GCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT 15: 72,801,290 probably benign Het
Triobp CAGGACT CAGGACTGCCTGTGCCCAACGGAACAACCCAAGGACT 15: 78,967,039 probably benign Het
Zfhx3 AACAGCAGC AACAGCAGCTACAGCAGC 8: 108,956,096 probably benign Het
Other mutations in Zfp933
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00576:Zfp933 APN 4 147826321 missense probably damaging 1.00
IGL03377:Zfp933 APN 4 147828711 missense possibly damaging 0.65
F5770:Zfp933 UTSW 4 147826470 missense probably damaging 0.98
FR4340:Zfp933 UTSW 4 147825729 frame shift probably null
FR4548:Zfp933 UTSW 4 147825731 frame shift probably null
R0388:Zfp933 UTSW 4 147826442 missense probably benign 0.35
R0523:Zfp933 UTSW 4 147826462 nonsense probably null
R0539:Zfp933 UTSW 4 147826548 missense probably benign 0.08
R1672:Zfp933 UTSW 4 147826019 missense probably damaging 1.00
R4049:Zfp933 UTSW 4 147826512 missense probably damaging 1.00
R4895:Zfp933 UTSW 4 147826435 nonsense probably null
R5133:Zfp933 UTSW 4 147826864 missense probably benign
R5786:Zfp933 UTSW 4 147828407 splice site probably null
R5891:Zfp933 UTSW 4 147826774 missense probably benign 0.03
R6111:Zfp933 UTSW 4 147828760 missense probably damaging 1.00
R6382:Zfp933 UTSW 4 147825868 missense probably benign 0.07
R6968:Zfp933 UTSW 4 147826197 missense probably damaging 1.00
R7195:Zfp933 UTSW 4 147826179 missense probably benign 0.16
R7555:Zfp933 UTSW 4 147826132 missense probably damaging 1.00
R7902:Zfp933 UTSW 4 147826601 missense probably damaging 0.96
R8319:Zfp933 UTSW 4 147828453 missense possibly damaging 0.87
RF024:Zfp933 UTSW 4 147826441 missense probably damaging 1.00
RF035:Zfp933 UTSW 4 147825731 makesense probably null
RF043:Zfp933 UTSW 4 147825731 frame shift probably null
V7581:Zfp933 UTSW 4 147826470 missense probably damaging 0.98
V7582:Zfp933 UTSW 4 147826470 missense probably damaging 0.98
V7583:Zfp933 UTSW 4 147826470 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTTCAGAACCTCAACGACTACTGG -3'
(R):5'- GGACACATACTGGAGAGAAACCTTATG -3'

Sequencing Primer
(F):5'- TCAACGACTACTGGGATCTGCAG -3'
(R):5'- TGTATGTAATCAATGTGGTAAAGCC -3'
Posted On2019-12-04