Incidental Mutation 'RF028:Thegl'
ID604227
Institutional Source Beutler Lab
Gene Symbol Thegl
Ensembl Gene ENSMUSG00000029248
Gene Nametheg spermatid protein like
Synonyms1700023E05Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #RF028 (G1)
Quality Score217.468
Status Not validated
Chromosome5
Chromosomal Location77016023-77061529 bp(+) (GRCm38)
Type of Mutationsmall insertion (9 aa in frame mutation)
DNA Base Change (assembly) AGCGATCCTCCCCAGTCCCGCAAGGCC to AGCGATCCTCCCCAGTCCCGCAAGGCCCGCGATCCTCCCCAGTCCCGCAAGGCC at 77016401 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031161] [ENSMUST00000117880]
Predicted Effect probably benign
Transcript: ENSMUST00000031161
SMART Domains Protein: ENSMUSP00000031161
Gene: ENSMUSG00000029248

DomainStartEndE-ValueType
low complexity region 21 30 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
THEG 172 190 4.56e2 SMART
THEG 212 231 5.84e0 SMART
THEG 258 277 3.1e-1 SMART
THEG 291 310 8.37e2 SMART
THEG 327 346 7.65e1 SMART
THEG 367 386 3.61e1 SMART
THEG 403 422 1.15e1 SMART
THEG 440 459 9.98e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117880
SMART Domains Protein: ENSMUSP00000112814
Gene: ENSMUSG00000029248

DomainStartEndE-ValueType
low complexity region 21 30 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
THEG 172 190 4.56e2 SMART
THEG 212 231 5.84e0 SMART
THEG 258 277 3.1e-1 SMART
THEG 291 310 8.37e2 SMART
THEG 327 346 7.65e1 SMART
THEG 367 386 3.61e1 SMART
THEG 403 422 1.15e1 SMART
THEG 440 459 9.98e0 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik GCTGTG GCTGTGCCTCCTGTG 1: 82,913,578 probably benign Het
A030005L19Rik TGTGGCTGC TGTGGCTGCCGTGGCTGC 1: 82,913,580 probably benign Het
Acap3 TGCATCCTGGGCTGC TGCATCCTGGGCTGCAGCATCCTGGGCTGC 4: 155,905,091 probably benign Het
Arid1b C CGGG 17: 4,995,598 probably benign Het
Blm CCTCCTCCTCCTCCTCCTCCTCCT CCTCCTCCTCCTACTCCTCCTCCTCCTCCTCCTCCT 7: 80,512,905 probably null Het
Boc GAC G 16: 44,496,433 probably null Het
Cacna1f GAG GAGAAG X: 7,620,060 probably benign Het
Cacna1f GAG GAGAAG X: 7,620,063 probably benign Het
Catsper2 ATCGCTTTCCTCGTTTTCG ATCG 2: 121,397,726 probably benign Het
Dbr1 GAGGAG GAGGAGTAGGAG 9: 99,583,697 probably null Het
E4f1 CGC CGCGGC 17: 24,455,190 probably benign Het
Eps8 TCGCTC TCGCTCGCTC 6: 137,517,063 probably benign Het
Ermn AACT AACTACT 2: 58,048,066 probably benign Het
Fsip2 TAGATGTGAAACCCTTAGAGGTAAGATGTGAAACTCTTAGAGGTAAGA TAGATGTGAAACTCTTAGAGGTAAGA 2: 82,994,008 probably null Het
Gab3 CTTCTT CTTATTCTT X: 75,000,000 probably null Het
Gab3 TCT TCTGCT X: 75,000,017 probably benign Het
Gabre CTC CTCTGGGTC X: 72,270,763 probably benign Het
Gm7579 GGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGATGCAAGGGAGGCTGTGGCTCCTGTGGGGG GGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGATGCAAGGGAGGCTGTGGCTCCTGTGGGGG 7: 142,212,045 probably benign Het
Gm8369 TG TGGGTGAG 19: 11,511,773 probably null Het
Hsdl2 CAGCTGCAG CAGCTGCAGCAGCAGCCATAGCTGCAG 4: 59,610,650 probably null Het
Iqcf4 TTTTCCTTTT TTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCGTTTCCTTTT 9: 106,570,614 probably benign Het
Kmt2e TTT TTTTATT 5: 23,478,509 probably benign Het
Kri1 CTCCTCCT C 9: 21,281,071 probably null Het
Krtap28-10 AGCCACAGCCACCACAGCCACAGCCACCAC AGCCACAGCCACCACCGCCACAGCCACCACAGCCACAGCCACCAC 1: 83,042,258 probably benign Het
Lce1m GTTGCTGCCACTG GTTGCTGCCACTGTTGCTGCCACTG 3: 93,018,131 probably benign Het
Lor CGCCGCCT C 3: 92,081,899 probably null Het
Luzp1 A AGGTGGCCTCTTCAGG 4: 136,543,196 probably benign Het
Lypd8 CCAACA CCAACAGGTCCCTCGCCTCTGTTACCCCACAAATAAACAACA 11: 58,390,239 probably benign Het
Mn1 CAG CAGGAG 5: 111,419,711 probably benign Het
Nefh GGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGACTTGGCCTCACCTGTGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,012 probably benign Het
Nefh GGGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGGACTTGGCCTCACCTTGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,029 probably benign Het
Nf2 AAAAG A 11: 4,829,936 probably null Het
Nusap1 AGAT AGATCCACGTTAGCAGTGAGGAGCAAGCTGCGAT 2: 119,627,578 probably benign Het
Nusap1 CAGTGAGGAGCAAGCTGAGA CAGTGAGGAGCAAGCTGAGATACACGTTAGTAGTGAGGAGCAAGCTGAGA 2: 119,627,591 probably benign Het
Phf20 CCCCCC CCCCCCGCCCCC 2: 156,304,623 probably benign Het
Ppp1r8 TCTCTCTCAC TC 4: 132,830,615 probably benign Het
Prr5l GCCTC G 2: 101,797,573 probably null Het
Rbm12 CGGGACCGGGCATTGCGGGACCGGGCATTGCGGG CGG 2: 156,096,130 probably null Het
Rpgrip1 GA GAGTA 14: 52,149,398 probably null Het
Tanc1 GTGAGCAGAAACCAGCATTTAGAGGGAACCGGTCCCTTCACTGCAGGAA G 2: 59,843,269 probably benign Het
Tfeb GCA GCATCA 17: 47,786,097 probably benign Het
Tgoln1 T TTGTCTTGTCAGAATCACCTCCTGG 6: 72,616,036 probably benign Het
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Trappc9 GCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT GCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT 15: 72,801,290 probably benign Het
Triobp CAGGACT CAGGACTGCCTGTGCCCAACGGAACAACCCAAGGACT 15: 78,967,039 probably benign Het
Zfhx3 AACAGCAGC AACAGCAGCTACAGCAGC 8: 108,956,096 probably benign Het
Zfp933 TT TTTGCCT 4: 147,825,731 probably null Het
Other mutations in Thegl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Thegl APN 5 77060831 missense probably damaging 1.00
IGL02008:Thegl APN 5 77060758 missense probably benign 0.01
IGL02014:Thegl APN 5 77047155 missense probably damaging 0.99
IGL02525:Thegl APN 5 77016553 missense probably benign 0.08
IGL03036:Thegl APN 5 77016350 missense possibly damaging 0.86
IGL03200:Thegl APN 5 77060864 missense possibly damaging 0.66
IGL03302:Thegl APN 5 77054576 missense probably benign 0.09
R0242:Thegl UTSW 5 77016305 nonsense probably null
R0242:Thegl UTSW 5 77016305 nonsense probably null
R0483:Thegl UTSW 5 77037357 splice site probably benign
R1875:Thegl UTSW 5 77054584 missense probably benign 0.29
R2121:Thegl UTSW 5 77060758 missense probably benign 0.01
R2232:Thegl UTSW 5 77059405 missense possibly damaging 0.84
R2280:Thegl UTSW 5 77059367 missense probably damaging 1.00
R2281:Thegl UTSW 5 77059367 missense probably damaging 1.00
R4422:Thegl UTSW 5 77054536 missense possibly damaging 0.91
R4423:Thegl UTSW 5 77054536 missense possibly damaging 0.91
R4424:Thegl UTSW 5 77054536 missense possibly damaging 0.91
R4935:Thegl UTSW 5 77037353 critical splice donor site probably null
R5041:Thegl UTSW 5 77056081 missense probably benign 0.05
R5175:Thegl UTSW 5 77016470 missense probably benign 0.00
R5560:Thegl UTSW 5 77016486 missense possibly damaging 0.61
R6086:Thegl UTSW 5 77061305 missense probably benign 0.11
R6193:Thegl UTSW 5 77016336 missense possibly damaging 0.85
R7070:Thegl UTSW 5 77047277 critical splice donor site probably null
R7453:Thegl UTSW 5 77060786 missense probably damaging 1.00
R7703:Thegl UTSW 5 77016597 missense probably benign 0.34
RF007:Thegl UTSW 5 77016408 small insertion probably benign
RF010:Thegl UTSW 5 77016427 small insertion probably benign
RF014:Thegl UTSW 5 77016400 small insertion probably benign
RF016:Thegl UTSW 5 77016408 small insertion probably benign
RF020:Thegl UTSW 5 77016400 small insertion probably benign
RF030:Thegl UTSW 5 77016401 small insertion probably benign
RF031:Thegl UTSW 5 77016410 small insertion probably benign
RF033:Thegl UTSW 5 77016405 small insertion probably benign
RF033:Thegl UTSW 5 77016429 small insertion probably benign
RF036:Thegl UTSW 5 77016429 small insertion probably benign
RF037:Thegl UTSW 5 77016421 small insertion probably benign
RF039:Thegl UTSW 5 77016402 small insertion probably benign
RF044:Thegl UTSW 5 77016405 small insertion probably benign
RF046:Thegl UTSW 5 77016403 small insertion probably benign
RF055:Thegl UTSW 5 77016403 small insertion probably benign
RF060:Thegl UTSW 5 77016427 small insertion probably benign
RF063:Thegl UTSW 5 77016426 small insertion probably benign
RF064:Thegl UTSW 5 77016415 small insertion probably benign
Z1176:Thegl UTSW 5 77060794 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTCTCAGGTTCATCCGTGCG -3'
(R):5'- CTGCGTTGGGAAACAAATCATC -3'

Sequencing Primer
(F):5'- TTCATCCGTGCGATCCGAG -3'
(R):5'- GCGTTGGGAAACAAATCATCTTTTCC -3'
Posted On2019-12-04