Incidental Mutation 'RF028:Tgoln1'
ID604229
Institutional Source Beutler Lab
Gene Symbol Tgoln1
Ensembl Gene ENSMUSG00000056429
Gene Nametrans-golgi network protein
SynonymsTtgn1, D6Ertd384e, TGN38, TGN38A
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #RF028 (G1)
Quality Score217.468
Status Not validated
Chromosome6
Chromosomal Location72608432-72617000 bp(-) (GRCm38)
Type of Mutationsmall insertion (8 aa in frame mutation)
DNA Base Change (assembly) T to TTGTCTTGTCAGAATCACCTCCTGG at 72616036 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000068487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070524]
Predicted Effect probably benign
Transcript: ENSMUST00000070524
SMART Domains Protein: ENSMUSP00000068487
Gene: ENSMUSG00000056429

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 58 74 N/A INTRINSIC
low complexity region 238 260 N/A INTRINSIC
transmembrane domain 300 319 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik GCTGTG GCTGTGCCTCCTGTG 1: 82,913,578 probably benign Het
A030005L19Rik TGTGGCTGC TGTGGCTGCCGTGGCTGC 1: 82,913,580 probably benign Het
Acap3 TGCATCCTGGGCTGC TGCATCCTGGGCTGCAGCATCCTGGGCTGC 4: 155,905,091 probably benign Het
Arid1b C CGGG 17: 4,995,598 probably benign Het
Blm CCTCCTCCTCCTCCTCCTCCTCCT CCTCCTCCTCCTACTCCTCCTCCTCCTCCTCCTCCT 7: 80,512,905 probably null Het
Boc GAC G 16: 44,496,433 probably null Het
Cacna1f GAG GAGAAG X: 7,620,060 probably benign Het
Cacna1f GAG GAGAAG X: 7,620,063 probably benign Het
Catsper2 ATCGCTTTCCTCGTTTTCG ATCG 2: 121,397,726 probably benign Het
Dbr1 GAGGAG GAGGAGTAGGAG 9: 99,583,697 probably null Het
E4f1 CGC CGCGGC 17: 24,455,190 probably benign Het
Eps8 TCGCTC TCGCTCGCTC 6: 137,517,063 probably benign Het
Ermn AACT AACTACT 2: 58,048,066 probably benign Het
Fsip2 TAGATGTGAAACCCTTAGAGGTAAGATGTGAAACTCTTAGAGGTAAGA TAGATGTGAAACTCTTAGAGGTAAGA 2: 82,994,008 probably null Het
Gab3 CTTCTT CTTATTCTT X: 75,000,000 probably null Het
Gab3 TCT TCTGCT X: 75,000,017 probably benign Het
Gabre CTC CTCTGGGTC X: 72,270,763 probably benign Het
Gm7579 GGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGATGCAAGGGAGGCTGTGGCTCCTGTGGGGG GGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGATGCAAGGGAGGCTGTGGCTCCTGTGGGGG 7: 142,212,045 probably benign Het
Gm8369 TG TGGGTGAG 19: 11,511,773 probably null Het
Hsdl2 CAGCTGCAG CAGCTGCAGCAGCAGCCATAGCTGCAG 4: 59,610,650 probably null Het
Iqcf4 TTTTCCTTTT TTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCGTTTCCTTTT 9: 106,570,614 probably benign Het
Kmt2e TTT TTTTATT 5: 23,478,509 probably benign Het
Kri1 CTCCTCCT C 9: 21,281,071 probably null Het
Krtap28-10 AGCCACAGCCACCACAGCCACAGCCACCAC AGCCACAGCCACCACCGCCACAGCCACCACAGCCACAGCCACCAC 1: 83,042,258 probably benign Het
Lce1m GTTGCTGCCACTG GTTGCTGCCACTGTTGCTGCCACTG 3: 93,018,131 probably benign Het
Lor CGCCGCCT C 3: 92,081,899 probably null Het
Luzp1 A AGGTGGCCTCTTCAGG 4: 136,543,196 probably benign Het
Lypd8 CCAACA CCAACAGGTCCCTCGCCTCTGTTACCCCACAAATAAACAACA 11: 58,390,239 probably benign Het
Mn1 CAG CAGGAG 5: 111,419,711 probably benign Het
Nefh GGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGACTTGGCCTCACCTGTGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,012 probably benign Het
Nefh GGGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGGACTTGGCCTCACCTTGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,029 probably benign Het
Nf2 AAAAG A 11: 4,829,936 probably null Het
Nusap1 AGAT AGATCCACGTTAGCAGTGAGGAGCAAGCTGCGAT 2: 119,627,578 probably benign Het
Nusap1 CAGTGAGGAGCAAGCTGAGA CAGTGAGGAGCAAGCTGAGATACACGTTAGTAGTGAGGAGCAAGCTGAGA 2: 119,627,591 probably benign Het
Phf20 CCCCCC CCCCCCGCCCCC 2: 156,304,623 probably benign Het
Ppp1r8 TCTCTCTCAC TC 4: 132,830,615 probably benign Het
Prr5l GCCTC G 2: 101,797,573 probably null Het
Rbm12 CGGGACCGGGCATTGCGGGACCGGGCATTGCGGG CGG 2: 156,096,130 probably null Het
Rpgrip1 GA GAGTA 14: 52,149,398 probably null Het
Tanc1 GTGAGCAGAAACCAGCATTTAGAGGGAACCGGTCCCTTCACTGCAGGAA G 2: 59,843,269 probably benign Het
Tfeb GCA GCATCA 17: 47,786,097 probably benign Het
Thegl AGCGATCCTCCCCAGTCCCGCAAGGCC AGCGATCCTCCCCAGTCCCGCAAGGCCCGCGATCCTCCCCAGTCCCGCAAGGCC 5: 77,016,401 probably benign Het
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Trappc9 GCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT GCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT 15: 72,801,290 probably benign Het
Triobp CAGGACT CAGGACTGCCTGTGCCCAACGGAACAACCCAAGGACT 15: 78,967,039 probably benign Het
Zfhx3 AACAGCAGC AACAGCAGCTACAGCAGC 8: 108,956,096 probably benign Het
Zfp933 TT TTTGCCT 4: 147,825,731 probably null Het
Other mutations in Tgoln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Tgoln1 APN 6 72616090 missense probably benign 0.00
IGL00795:Tgoln1 APN 6 72616252 missense probably benign 0.01
IGL03002:Tgoln1 APN 6 72616072 missense possibly damaging 0.83
IGL03136:Tgoln1 APN 6 72614113 missense probably damaging 1.00
FR4340:Tgoln1 UTSW 6 72616351 small insertion probably benign
R0684:Tgoln1 UTSW 6 72615991 missense probably benign 0.00
R1656:Tgoln1 UTSW 6 72614085 missense probably damaging 0.99
R1920:Tgoln1 UTSW 6 72616101 missense probably benign 0.01
R2057:Tgoln1 UTSW 6 72615670 missense probably benign 0.35
R4097:Tgoln1 UTSW 6 72615801 missense probably damaging 0.98
R4559:Tgoln1 UTSW 6 72615681 missense probably damaging 0.98
R4995:Tgoln1 UTSW 6 72616140 missense possibly damaging 0.92
R5566:Tgoln1 UTSW 6 72616035 missense possibly damaging 0.92
R6224:Tgoln1 UTSW 6 72616001 missense possibly damaging 0.81
R6814:Tgoln1 UTSW 6 72615555 missense possibly damaging 0.90
R6872:Tgoln1 UTSW 6 72615555 missense possibly damaging 0.90
R7178:Tgoln1 UTSW 6 72616045 missense probably benign 0.01
R7339:Tgoln1 UTSW 6 72616278 missense probably benign 0.03
R7342:Tgoln1 UTSW 6 72616278 missense probably benign 0.03
R7347:Tgoln1 UTSW 6 72616278 missense probably benign 0.03
R7348:Tgoln1 UTSW 6 72616278 missense probably benign 0.03
R7366:Tgoln1 UTSW 6 72616278 missense probably benign 0.03
R7368:Tgoln1 UTSW 6 72616278 missense probably benign 0.03
R7491:Tgoln1 UTSW 6 72616420 missense unknown
RF003:Tgoln1 UTSW 6 72616352 nonsense probably null
RF023:Tgoln1 UTSW 6 72616080 small insertion probably benign
RF030:Tgoln1 UTSW 6 72616036 small insertion probably benign
RF030:Tgoln1 UTSW 6 72616063 small insertion probably benign
RF032:Tgoln1 UTSW 6 72616063 small insertion probably benign
RF032:Tgoln1 UTSW 6 72616074 small insertion probably benign
RF037:Tgoln1 UTSW 6 72616036 small insertion probably benign
RF040:Tgoln1 UTSW 6 72616074 small insertion probably benign
RF042:Tgoln1 UTSW 6 72616074 small insertion probably benign
RF043:Tgoln1 UTSW 6 72616036 small insertion probably benign
RF043:Tgoln1 UTSW 6 72616063 small insertion probably benign
RF057:Tgoln1 UTSW 6 72616069 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- CCCCAGATTCAGTTTTGGAAGTAAG -3'
(R):5'- TCCAGTAAGGCGGAATCTGG -3'

Sequencing Primer
(F):5'- AGATTCAGTTTTGGAAGTAAGTGTTG -3'
(R):5'- CACAGTTTGGGTGATTCCAGAAG -3'
Posted On2019-12-04