Incidental Mutation 'RF028:Eps8'
ID604230
Institutional Source Beutler Lab
Gene Symbol Eps8
Ensembl Gene ENSMUSG00000015766
Gene Nameepidermal growth factor receptor pathway substrate 8
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.413) question?
Stock #RF028 (G1)
Quality Score188.46
Status Not validated
Chromosome6
Chromosomal Location137477245-137654876 bp(-) (GRCm38)
Type of Mutationcritical splice donor site
DNA Base Change (assembly) TCGCTC to TCGCTCGCTC at 137517063 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000052776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058210] [ENSMUST00000100841] [ENSMUST00000111878] [ENSMUST00000132920] [ENSMUST00000147526]
PDB Structure
THE SH3 DOMAIN OF EPS8 EXISTS AS A NOVEL INTERTWINED DIMER [X-RAY DIFFRACTION]
EPS8 SH3 DOMAIN INTERTWINED DIMER [X-RAY DIFFRACTION]
EPS8 SH3 CLOSED MONOMER [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000058210
SMART Domains Protein: ENSMUSP00000052776
Gene: ENSMUSG00000015766

DomainStartEndE-ValueType
PTB 60 197 8.38e-34 SMART
low complexity region 203 221 N/A INTRINSIC
low complexity region 229 241 N/A INTRINSIC
low complexity region 298 309 N/A INTRINSIC
SH3 533 588 5.48e-14 SMART
low complexity region 620 651 N/A INTRINSIC
Blast:SH3 652 686 6e-6 BLAST
PDB:2E8M|A 698 783 5e-50 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000100841
SMART Domains Protein: ENSMUSP00000098402
Gene: ENSMUSG00000015766

DomainStartEndE-ValueType
PTB 60 197 8.38e-34 SMART
low complexity region 203 221 N/A INTRINSIC
low complexity region 229 241 N/A INTRINSIC
low complexity region 298 309 N/A INTRINSIC
SH3 533 588 5.48e-14 SMART
low complexity region 620 651 N/A INTRINSIC
Blast:SH3 652 686 6e-6 BLAST
PDB:2E8M|A 698 783 5e-50 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000111878
SMART Domains Protein: ENSMUSP00000107509
Gene: ENSMUSG00000015766

DomainStartEndE-ValueType
PTB 60 197 8.38e-34 SMART
low complexity region 203 221 N/A INTRINSIC
low complexity region 229 241 N/A INTRINSIC
low complexity region 298 309 N/A INTRINSIC
SH3 533 588 5.48e-14 SMART
low complexity region 620 651 N/A INTRINSIC
Blast:SH3 652 686 6e-6 BLAST
PDB:2E8M|A 698 783 5e-50 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000132920
SMART Domains Protein: ENSMUSP00000122517
Gene: ENSMUSG00000015766

DomainStartEndE-ValueType
low complexity region 54 66 N/A INTRINSIC
PTB 77 214 8.38e-34 SMART
low complexity region 220 238 N/A INTRINSIC
low complexity region 246 258 N/A INTRINSIC
low complexity region 315 326 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147526
SMART Domains Protein: ENSMUSP00000120044
Gene: ENSMUSG00000015766

DomainStartEndE-ValueType
PTB 60 197 8.38e-34 SMART
low complexity region 203 221 N/A INTRINSIC
low complexity region 229 241 N/A INTRINSIC
low complexity region 298 309 N/A INTRINSIC
SH3 533 587 4.56e-11 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the EPS8 family. This protein contains one PH domain and one SH3 domain. It functions as part of the EGFR pathway, though its exact role has not been determined. Highly similar proteins in other organisms are involved in the transduction of signals from Ras to Rac and growth factor-mediated actin remodeling. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in resistance to some of the intoxicating effects of ethanol and increased ethanol consumption. NMDA receptor currents and their sensitivity to inhibition by ethanol are abnormal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik GCTGTG GCTGTGCCTCCTGTG 1: 82,913,578 probably benign Het
A030005L19Rik TGTGGCTGC TGTGGCTGCCGTGGCTGC 1: 82,913,580 probably benign Het
Acap3 TGCATCCTGGGCTGC TGCATCCTGGGCTGCAGCATCCTGGGCTGC 4: 155,905,091 probably benign Het
Arid1b C CGGG 17: 4,995,598 probably benign Het
Blm CCTCCTCCTCCTCCTCCTCCTCCT CCTCCTCCTCCTACTCCTCCTCCTCCTCCTCCTCCT 7: 80,512,905 probably null Het
Boc GAC G 16: 44,496,433 probably null Het
Cacna1f GAG GAGAAG X: 7,620,060 probably benign Het
Cacna1f GAG GAGAAG X: 7,620,063 probably benign Het
Catsper2 ATCGCTTTCCTCGTTTTCG ATCG 2: 121,397,726 probably benign Het
Dbr1 GAGGAG GAGGAGTAGGAG 9: 99,583,697 probably null Het
E4f1 CGC CGCGGC 17: 24,455,190 probably benign Het
Ermn AACT AACTACT 2: 58,048,066 probably benign Het
Fsip2 TAGATGTGAAACCCTTAGAGGTAAGATGTGAAACTCTTAGAGGTAAGA TAGATGTGAAACTCTTAGAGGTAAGA 2: 82,994,008 probably null Het
Gab3 CTTCTT CTTATTCTT X: 75,000,000 probably null Het
Gab3 TCT TCTGCT X: 75,000,017 probably benign Het
Gabre CTC CTCTGGGTC X: 72,270,763 probably benign Het
Gm7579 GGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGATGCAAGGGAGGCTGTGGCTCCTGTGGGGG GGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGATGCAAGGGAGGCTGTGGCTCCTGTGGGGG 7: 142,212,045 probably benign Het
Gm8369 TG TGGGTGAG 19: 11,511,773 probably null Het
Hsdl2 CAGCTGCAG CAGCTGCAGCAGCAGCCATAGCTGCAG 4: 59,610,650 probably null Het
Iqcf4 TTTTCCTTTT TTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCGTTTCCTTTT 9: 106,570,614 probably benign Het
Kmt2e TTT TTTTATT 5: 23,478,509 probably benign Het
Kri1 CTCCTCCT C 9: 21,281,071 probably null Het
Krtap28-10 AGCCACAGCCACCACAGCCACAGCCACCAC AGCCACAGCCACCACCGCCACAGCCACCACAGCCACAGCCACCAC 1: 83,042,258 probably benign Het
Lce1m GTTGCTGCCACTG GTTGCTGCCACTGTTGCTGCCACTG 3: 93,018,131 probably benign Het
Lor CGCCGCCT C 3: 92,081,899 probably null Het
Luzp1 A AGGTGGCCTCTTCAGG 4: 136,543,196 probably benign Het
Lypd8 CCAACA CCAACAGGTCCCTCGCCTCTGTTACCCCACAAATAAACAACA 11: 58,390,239 probably benign Het
Mn1 CAG CAGGAG 5: 111,419,711 probably benign Het
Nefh GGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGACTTGGCCTCACCTGTGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,012 probably benign Het
Nefh GGGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGGACTTGGCCTCACCTTGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,029 probably benign Het
Nf2 AAAAG A 11: 4,829,936 probably null Het
Nusap1 AGAT AGATCCACGTTAGCAGTGAGGAGCAAGCTGCGAT 2: 119,627,578 probably benign Het
Nusap1 CAGTGAGGAGCAAGCTGAGA CAGTGAGGAGCAAGCTGAGATACACGTTAGTAGTGAGGAGCAAGCTGAGA 2: 119,627,591 probably benign Het
Phf20 CCCCCC CCCCCCGCCCCC 2: 156,304,623 probably benign Het
Ppp1r8 TCTCTCTCAC TC 4: 132,830,615 probably benign Het
Prr5l GCCTC G 2: 101,797,573 probably null Het
Rbm12 CGGGACCGGGCATTGCGGGACCGGGCATTGCGGG CGG 2: 156,096,130 probably null Het
Rpgrip1 GA GAGTA 14: 52,149,398 probably null Het
Tanc1 GTGAGCAGAAACCAGCATTTAGAGGGAACCGGTCCCTTCACTGCAGGAA G 2: 59,843,269 probably benign Het
Tfeb GCA GCATCA 17: 47,786,097 probably benign Het
Tgoln1 T TTGTCTTGTCAGAATCACCTCCTGG 6: 72,616,036 probably benign Het
Thegl AGCGATCCTCCCCAGTCCCGCAAGGCC AGCGATCCTCCCCAGTCCCGCAAGGCCCGCGATCCTCCCCAGTCCCGCAAGGCC 5: 77,016,401 probably benign Het
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Trappc9 GCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT GCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT 15: 72,801,290 probably benign Het
Triobp CAGGACT CAGGACTGCCTGTGCCCAACGGAACAACCCAAGGACT 15: 78,967,039 probably benign Het
Zfhx3 AACAGCAGC AACAGCAGCTACAGCAGC 8: 108,956,096 probably benign Het
Zfp933 TT TTTGCCT 4: 147,825,731 probably null Het
Other mutations in Eps8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Eps8 APN 6 137505479 missense probably benign 0.00
IGL00499:Eps8 APN 6 137522888 nonsense probably null
IGL01587:Eps8 APN 6 137514713 missense probably damaging 1.00
IGL01789:Eps8 APN 6 137539366 missense probably benign 0.01
IGL01836:Eps8 APN 6 137483541 critical splice donor site probably null
IGL01951:Eps8 APN 6 137537671 missense possibly damaging 0.66
IGL02478:Eps8 APN 6 137522842 missense probably benign 0.05
IGL02546:Eps8 APN 6 137479066 missense probably benign 0.30
IGL02861:Eps8 APN 6 137499599 missense probably damaging 1.00
IGL03115:Eps8 APN 6 137527381 missense probably damaging 1.00
IGL03355:Eps8 APN 6 137512145 splice site probably benign
FR4589:Eps8 UTSW 6 137517069 frame shift probably null
R0113:Eps8 UTSW 6 137537684 missense possibly damaging 0.87
R0245:Eps8 UTSW 6 137479128 missense probably benign 0.01
R0462:Eps8 UTSW 6 137514311 missense probably benign 0.00
R0905:Eps8 UTSW 6 137514307 missense probably benign 0.23
R1106:Eps8 UTSW 6 137514324 missense probably damaging 1.00
R1178:Eps8 UTSW 6 137522854 missense possibly damaging 0.46
R1181:Eps8 UTSW 6 137522854 missense possibly damaging 0.46
R1448:Eps8 UTSW 6 137522854 missense possibly damaging 0.46
R1612:Eps8 UTSW 6 137500618 missense probably benign 0.00
R1835:Eps8 UTSW 6 137522279 nonsense probably null
R2068:Eps8 UTSW 6 137522174 missense probably benign 0.13
R2113:Eps8 UTSW 6 137537635 unclassified probably null
R2943:Eps8 UTSW 6 137522872 missense probably damaging 1.00
R3032:Eps8 UTSW 6 137512177 missense probably damaging 0.96
R3879:Eps8 UTSW 6 137527362 splice site probably benign
R3973:Eps8 UTSW 6 137509155 missense probably benign 0.00
R4199:Eps8 UTSW 6 137514327 missense probably damaging 0.96
R4384:Eps8 UTSW 6 137499592 missense probably benign 0.30
R4728:Eps8 UTSW 6 137509162 nonsense probably null
R4840:Eps8 UTSW 6 137527130 missense probably damaging 1.00
R4860:Eps8 UTSW 6 137514295 missense probably damaging 0.97
R4860:Eps8 UTSW 6 137514295 missense probably damaging 0.97
R4864:Eps8 UTSW 6 137478969 utr 3 prime probably benign
R5197:Eps8 UTSW 6 137490290 missense probably damaging 0.97
R5197:Eps8 UTSW 6 137490291 missense possibly damaging 0.91
R5214:Eps8 UTSW 6 137527492 missense probably damaging 0.99
R5457:Eps8 UTSW 6 137512177 missense probably damaging 0.96
R5464:Eps8 UTSW 6 137527475 missense probably damaging 1.00
R5557:Eps8 UTSW 6 137479096 missense possibly damaging 0.90
R5981:Eps8 UTSW 6 137482210 missense probably damaging 0.98
R6150:Eps8 UTSW 6 137517174 missense probably damaging 1.00
R6473:Eps8 UTSW 6 137479098 missense probably damaging 1.00
R6529:Eps8 UTSW 6 137514337 missense possibly damaging 0.92
R6574:Eps8 UTSW 6 137483598 nonsense probably null
R6890:Eps8 UTSW 6 137512257 missense probably damaging 0.99
R7180:Eps8 UTSW 6 137479074 missense possibly damaging 0.78
R7229:Eps8 UTSW 6 137539356 missense probably benign
R7314:Eps8 UTSW 6 137527092 missense possibly damaging 0.51
R7336:Eps8 UTSW 6 137509213 missense possibly damaging 0.75
R7784:Eps8 UTSW 6 137499587 missense probably benign 0.01
R7942:Eps8 UTSW 6 137530577 missense possibly damaging 0.53
R7988:Eps8 UTSW 6 137528571 missense possibly damaging 0.95
R7989:Eps8 UTSW 6 137528571 missense possibly damaging 0.95
R7991:Eps8 UTSW 6 137528571 missense possibly damaging 0.95
R8235:Eps8 UTSW 6 137483578 missense possibly damaging 0.62
R8262:Eps8 UTSW 6 137482254 missense probably benign 0.10
RF025:Eps8 UTSW 6 137517066 critical splice donor site probably benign
RF035:Eps8 UTSW 6 137517070 frame shift probably null
RF039:Eps8 UTSW 6 137517070 frame shift probably null
RF046:Eps8 UTSW 6 137517063 critical splice donor site probably benign
RF057:Eps8 UTSW 6 137517064 critical splice donor site probably benign
Z1177:Eps8 UTSW 6 137499581 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGGAACCTTACTCACCTGCAG -3'
(R):5'- CAGCTAGAACCAAATTACTTATGCC -3'

Sequencing Primer
(F):5'- AACCTTACTCACCTGCAGTCTGAC -3'
(R):5'- CCAAATTACTTATGCCTTTGTTTCAC -3'
Posted On2019-12-04