Incidental Mutation 'RF028:Blm'
ID604231
Institutional Source Beutler Lab
Gene Symbol Blm
Ensembl Gene ENSMUSG00000030528
Gene NameBloom syndrome, RecQ like helicase
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF028 (G1)
Quality Score217.468
Status Not validated
Chromosome7
Chromosomal Location80454733-80535119 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) CCTCCTCCTCCTCCTCCTCCTCCT to CCTCCTCCTCCTACTCCTCCTCCTCCTCCTCCTCCT at 80512905 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081314] [ENSMUST00000170315]
Predicted Effect probably null
Transcript: ENSMUST00000081314
SMART Domains Protein: ENSMUSP00000080062
Gene: ENSMUSG00000030528

DomainStartEndE-ValueType
low complexity region 46 54 N/A INTRINSIC
low complexity region 118 132 N/A INTRINSIC
low complexity region 142 169 N/A INTRINSIC
low complexity region 219 231 N/A INTRINSIC
low complexity region 318 335 N/A INTRINSIC
Pfam:BDHCT 376 416 5.5e-27 PFAM
low complexity region 557 574 N/A INTRINSIC
DEXDc 672 873 1.59e-29 SMART
HELICc 910 992 1.29e-24 SMART
RQC 1084 1198 1.43e-15 SMART
HRDC 1217 1297 9.4e-20 SMART
low complexity region 1357 1371 N/A INTRINSIC
low complexity region 1378 1392 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000170315
SMART Domains Protein: ENSMUSP00000127995
Gene: ENSMUSG00000030528

DomainStartEndE-ValueType
Pfam:BLM_N 4 375 1.1e-161 PFAM
Pfam:BDHCT 380 419 6.4e-25 PFAM
Pfam:BDHCT_assoc 433 658 8.8e-108 PFAM
DEXDc 675 876 1.59e-29 SMART
HELICc 913 995 1.29e-24 SMART
Pfam:RecQ_Zn_bind 1006 1078 1.5e-19 PFAM
RQC 1087 1201 1.43e-15 SMART
HRDC 1220 1300 9.4e-20 SMART
low complexity region 1360 1374 N/A INTRINSIC
low complexity region 1381 1395 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Bloom syndrome gene product is related to the RecQ subset of DExH box-containing DNA helicases and has both DNA-stimulated ATPase and ATP-dependent DNA helicase activities. Mutations causing Bloom syndrome delete or alter helicase motifs and may disable the 3'-5' helicase activity. The normal protein may act to suppress inappropriate recombination. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are developmentally delayed, with increased apopotosis in the epiblast and severe anemia, dying at embyronic day 13.5; but homozygotes for a cre mediated recombinant allele are viable Bloom syndrome-like mice prone to a wide variety of cancers and showing increased rates of LOH. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik GCTGTG GCTGTGCCTCCTGTG 1: 82,913,578 probably benign Het
A030005L19Rik TGTGGCTGC TGTGGCTGCCGTGGCTGC 1: 82,913,580 probably benign Het
Acap3 TGCATCCTGGGCTGC TGCATCCTGGGCTGCAGCATCCTGGGCTGC 4: 155,905,091 probably benign Het
Arid1b C CGGG 17: 4,995,598 probably benign Het
Boc GAC G 16: 44,496,433 probably null Het
Cacna1f GAG GAGAAG X: 7,620,060 probably benign Het
Cacna1f GAG GAGAAG X: 7,620,063 probably benign Het
Catsper2 ATCGCTTTCCTCGTTTTCG ATCG 2: 121,397,726 probably benign Het
Dbr1 GAGGAG GAGGAGTAGGAG 9: 99,583,697 probably null Het
E4f1 CGC CGCGGC 17: 24,455,190 probably benign Het
Eps8 TCGCTC TCGCTCGCTC 6: 137,517,063 probably benign Het
Ermn AACT AACTACT 2: 58,048,066 probably benign Het
Fsip2 TAGATGTGAAACCCTTAGAGGTAAGATGTGAAACTCTTAGAGGTAAGA TAGATGTGAAACTCTTAGAGGTAAGA 2: 82,994,008 probably null Het
Gab3 CTTCTT CTTATTCTT X: 75,000,000 probably null Het
Gab3 TCT TCTGCT X: 75,000,017 probably benign Het
Gabre CTC CTCTGGGTC X: 72,270,763 probably benign Het
Gm7579 GGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGATGCAAGGGAGGCTGTGGCTCCTGTGGGGG GGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGATGCAAGGGAGGCTGTGGCTCCTGTGGGGG 7: 142,212,045 probably benign Het
Gm8369 TG TGGGTGAG 19: 11,511,773 probably null Het
Hsdl2 CAGCTGCAG CAGCTGCAGCAGCAGCCATAGCTGCAG 4: 59,610,650 probably null Het
Iqcf4 TTTTCCTTTT TTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCGTTTCCTTTT 9: 106,570,614 probably benign Het
Kmt2e TTT TTTTATT 5: 23,478,509 probably benign Het
Kri1 CTCCTCCT C 9: 21,281,071 probably null Het
Krtap28-10 AGCCACAGCCACCACAGCCACAGCCACCAC AGCCACAGCCACCACCGCCACAGCCACCACAGCCACAGCCACCAC 1: 83,042,258 probably benign Het
Lce1m GTTGCTGCCACTG GTTGCTGCCACTGTTGCTGCCACTG 3: 93,018,131 probably benign Het
Lor CGCCGCCT C 3: 92,081,899 probably null Het
Luzp1 A AGGTGGCCTCTTCAGG 4: 136,543,196 probably benign Het
Lypd8 CCAACA CCAACAGGTCCCTCGCCTCTGTTACCCCACAAATAAACAACA 11: 58,390,239 probably benign Het
Mn1 CAG CAGGAG 5: 111,419,711 probably benign Het
Nefh GGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGACTTGGCCTCACCTGTGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,012 probably benign Het
Nefh GGGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGGACTTGGCCTCACCTTGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,029 probably benign Het
Nf2 AAAAG A 11: 4,829,936 probably null Het
Nusap1 AGAT AGATCCACGTTAGCAGTGAGGAGCAAGCTGCGAT 2: 119,627,578 probably benign Het
Nusap1 CAGTGAGGAGCAAGCTGAGA CAGTGAGGAGCAAGCTGAGATACACGTTAGTAGTGAGGAGCAAGCTGAGA 2: 119,627,591 probably benign Het
Phf20 CCCCCC CCCCCCGCCCCC 2: 156,304,623 probably benign Het
Ppp1r8 TCTCTCTCAC TC 4: 132,830,615 probably benign Het
Prr5l GCCTC G 2: 101,797,573 probably null Het
Rbm12 CGGGACCGGGCATTGCGGGACCGGGCATTGCGGG CGG 2: 156,096,130 probably null Het
Rpgrip1 GA GAGTA 14: 52,149,398 probably null Het
Tanc1 GTGAGCAGAAACCAGCATTTAGAGGGAACCGGTCCCTTCACTGCAGGAA G 2: 59,843,269 probably benign Het
Tfeb GCA GCATCA 17: 47,786,097 probably benign Het
Tgoln1 T TTGTCTTGTCAGAATCACCTCCTGG 6: 72,616,036 probably benign Het
Thegl AGCGATCCTCCCCAGTCCCGCAAGGCC AGCGATCCTCCCCAGTCCCGCAAGGCCCGCGATCCTCCCCAGTCCCGCAAGGCC 5: 77,016,401 probably benign Het
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Trappc9 GCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT GCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT 15: 72,801,290 probably benign Het
Triobp CAGGACT CAGGACTGCCTGTGCCCAACGGAACAACCCAAGGACT 15: 78,967,039 probably benign Het
Zfhx3 AACAGCAGC AACAGCAGCTACAGCAGC 8: 108,956,096 probably benign Het
Zfp933 TT TTTGCCT 4: 147,825,731 probably null Het
Other mutations in Blm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01531:Blm APN 7 80474071 missense probably damaging 1.00
IGL01658:Blm APN 7 80463941 missense probably damaging 0.98
IGL02048:Blm APN 7 80502961 splice site probably benign
IGL02060:Blm APN 7 80514580 splice site probably benign
IGL02063:Blm APN 7 80509419 nonsense probably null
IGL02102:Blm APN 7 80469756 missense probably damaging 1.00
IGL02420:Blm APN 7 80496006 missense probably damaging 1.00
IGL02452:Blm APN 7 80503377 splice site probably null
IGL02566:Blm APN 7 80474196 missense probably damaging 1.00
IGL03387:Blm APN 7 80494147 missense probably damaging 1.00
FR4304:Blm UTSW 7 80463773 frame shift probably null
FR4304:Blm UTSW 7 80512919 small insertion probably benign
FR4340:Blm UTSW 7 80463767 unclassified probably benign
FR4340:Blm UTSW 7 80512907 small insertion probably benign
FR4340:Blm UTSW 7 80512910 small insertion probably benign
FR4449:Blm UTSW 7 80512908 small insertion probably benign
FR4548:Blm UTSW 7 80463769 frame shift probably null
FR4589:Blm UTSW 7 80463770 frame shift probably null
FR4737:Blm UTSW 7 80463771 frame shift probably null
FR4737:Blm UTSW 7 80463774 frame shift probably null
FR4976:Blm UTSW 7 80463767 unclassified probably benign
FR4976:Blm UTSW 7 80512907 small insertion probably benign
R0133:Blm UTSW 7 80502367 missense possibly damaging 0.93
R0194:Blm UTSW 7 80464946 unclassified probably benign
R0526:Blm UTSW 7 80505893 nonsense probably null
R0673:Blm UTSW 7 80499751 critical splice donor site probably null
R0972:Blm UTSW 7 80513370 missense probably benign
R0980:Blm UTSW 7 80499958 splice site probably null
R1120:Blm UTSW 7 80481466 missense probably damaging 1.00
R1301:Blm UTSW 7 80455417 nonsense probably null
R1769:Blm UTSW 7 80513370 missense probably benign
R1866:Blm UTSW 7 80494114 missense probably benign 0.08
R1874:Blm UTSW 7 80497418 missense probably damaging 1.00
R1966:Blm UTSW 7 80513186 missense possibly damaging 0.86
R1991:Blm UTSW 7 80505949 splice site probably null
R2013:Blm UTSW 7 80502399 missense probably damaging 0.99
R2014:Blm UTSW 7 80502399 missense probably damaging 0.99
R2015:Blm UTSW 7 80502399 missense probably damaging 0.99
R2016:Blm UTSW 7 80505926 missense probably benign 0.26
R2103:Blm UTSW 7 80505949 splice site probably null
R2161:Blm UTSW 7 80481370 splice site probably null
R2215:Blm UTSW 7 80499847 missense possibly damaging 0.69
R3689:Blm UTSW 7 80513079 missense possibly damaging 0.56
R4049:Blm UTSW 7 80502862 missense probably benign 0.04
R4155:Blm UTSW 7 80512904 small deletion probably benign
R4695:Blm UTSW 7 80494228 missense probably damaging 1.00
R4774:Blm UTSW 7 80463848 missense probably damaging 1.00
R4833:Blm UTSW 7 80466826 missense probably benign
R4835:Blm UTSW 7 80509546 missense probably benign 0.41
R4994:Blm UTSW 7 80458825 missense probably benign 0.00
R5039:Blm UTSW 7 80505873 missense possibly damaging 0.50
R5330:Blm UTSW 7 80458936 missense possibly damaging 0.73
R5375:Blm UTSW 7 80513229 missense probably benign 0.00
R5408:Blm UTSW 7 80502622 missense probably benign 0.01
R5574:Blm UTSW 7 80499773 missense probably damaging 1.00
R5606:Blm UTSW 7 80460832 splice site probably null
R5702:Blm UTSW 7 80458927 missense probably benign 0.13
R5809:Blm UTSW 7 80464844 missense probably damaging 1.00
R6114:Blm UTSW 7 80513487 missense probably damaging 1.00
R6157:Blm UTSW 7 80512985 missense probably benign 0.18
R6163:Blm UTSW 7 80512904 small deletion probably benign
R6254:Blm UTSW 7 80480342 missense probably benign 0.04
R6266:Blm UTSW 7 80499940 missense probably benign 0.03
R6364:Blm UTSW 7 80494526 nonsense probably null
R6446:Blm UTSW 7 80512904 small deletion probably benign
R6502:Blm UTSW 7 80481475 missense probably damaging 0.98
R6700:Blm UTSW 7 80463850 missense possibly damaging 0.91
R7002:Blm UTSW 7 80469753 missense probably benign 0.00
R7105:Blm UTSW 7 80499768 missense probably benign 0.44
R7320:Blm UTSW 7 80455354 nonsense probably null
R7465:Blm UTSW 7 80513115 missense probably benign 0.02
R7561:Blm UTSW 7 80502528 missense probably damaging 0.99
RF001:Blm UTSW 7 80512903 small insertion probably benign
RF001:Blm UTSW 7 80512906 small insertion probably benign
RF001:Blm UTSW 7 80512927 small insertion probably benign
RF002:Blm UTSW 7 80512905 small insertion probably benign
RF002:Blm UTSW 7 80512927 small insertion probably benign
RF007:Blm UTSW 7 80512933 nonsense probably null
RF016:Blm UTSW 7 80512926 nonsense probably null
RF018:Blm UTSW 7 80512926 nonsense probably null
RF027:Blm UTSW 7 80512914 frame shift probably null
RF031:Blm UTSW 7 80512906 small insertion probably benign
RF031:Blm UTSW 7 80512923 small insertion probably benign
RF032:Blm UTSW 7 80512930 small insertion probably benign
RF036:Blm UTSW 7 80512914 nonsense probably null
RF044:Blm UTSW 7 80512930 small insertion probably benign
RF053:Blm UTSW 7 80512921 small insertion probably benign
RF064:Blm UTSW 7 80512923 nonsense probably null
X0061:Blm UTSW 7 80458850 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AACTGTCCTGTGTACCGCTG -3'
(R):5'- AGATGCGTTTGCTTCACTGG -3'

Sequencing Primer
(F):5'- CCCAGTGCTCAGCTTTAGATTAG -3'
(R):5'- GCTTCACTGGCTAAAAATCCTG -3'
Posted On2019-12-04