Incidental Mutation 'RF028:Gm7579'
Institutional Source Beutler Lab
Gene Symbol Gm7579
Ensembl Gene ENSMUSG00000073786
Gene Namepredicted gene 7579
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.253) question?
Stock #RF028 (G1)
Quality Score177.466
Status Not validated
Chromosomal Location142211859-142212590 bp(+) (GRCm38)
Type of Mutationsmall deletion (10 aa in frame mutation)
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097943]
Predicted Effect probably benign
Transcript: ENSMUST00000097943
SMART Domains Protein: ENSMUSP00000095556
Gene: ENSMUSG00000073786

Pfam:Keratin_B2_2 198 242 1.8e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097943
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik GCTGTG GCTGTGCCTCCTGTG 1: 82,913,578 probably benign Het
A030005L19Rik TGTGGCTGC TGTGGCTGCCGTGGCTGC 1: 82,913,580 probably benign Het
Arid1b C CGGG 17: 4,995,598 probably benign Het
Boc GAC G 16: 44,496,433 probably null Het
Cacna1f GAG GAGAAG X: 7,620,060 probably benign Het
Cacna1f GAG GAGAAG X: 7,620,063 probably benign Het
Catsper2 ATCGCTTTCCTCGTTTTCG ATCG 2: 121,397,726 probably benign Het
Dbr1 GAGGAG GAGGAGTAGGAG 9: 99,583,697 probably null Het
E4f1 CGC CGCGGC 17: 24,455,190 probably benign Het
Eps8 TCGCTC TCGCTCGCTC 6: 137,517,063 probably benign Het
Ermn AACT AACTACT 2: 58,048,066 probably benign Het
Gab3 CTTCTT CTTATTCTT X: 75,000,000 probably null Het
Gab3 TCT TCTGCT X: 75,000,017 probably benign Het
Gabre CTC CTCTGGGTC X: 72,270,763 probably benign Het
Gm8369 TG TGGGTGAG 19: 11,511,773 probably null Het
Kmt2e TTT TTTTATT 5: 23,478,509 probably benign Het
Kri1 CTCCTCCT C 9: 21,281,071 probably null Het
Lor CGCCGCCT C 3: 92,081,899 probably null Het
Luzp1 A AGGTGGCCTCTTCAGG 4: 136,543,196 probably benign Het
Mn1 CAG CAGGAG 5: 111,419,711 probably benign Het
Nf2 AAAAG A 11: 4,829,936 probably null Het
Nusap1 AGAT AGATCCACGTTAGCAGTGAGGAGCAAGCTGCGAT 2: 119,627,578 probably benign Het
Phf20 CCCCCC CCCCCCGCCCCC 2: 156,304,623 probably benign Het
Ppp1r8 TCTCTCTCAC TC 4: 132,830,615 probably benign Het
Prr5l GCCTC G 2: 101,797,573 probably null Het
Rpgrip1 GA GAGTA 14: 52,149,398 probably null Het
Tfeb GCA GCATCA 17: 47,786,097 probably benign Het
Tgoln1 T TTGTCTTGTCAGAATCACCTCCTGG 6: 72,616,036 probably benign Het
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Zfhx3 AACAGCAGC AACAGCAGCTACAGCAGC 8: 108,956,096 probably benign Het
Zfp933 TT TTTGCCT 4: 147,825,731 probably null Het
Other mutations in Gm7579
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0332:Gm7579 UTSW 7 142212375 missense unknown
R0594:Gm7579 UTSW 7 142212384 missense unknown
R1605:Gm7579 UTSW 7 142211866 missense unknown
R1804:Gm7579 UTSW 7 142211938 missense unknown
R4860:Gm7579 UTSW 7 142211908 missense unknown
R4860:Gm7579 UTSW 7 142211908 missense unknown
R6249:Gm7579 UTSW 7 142212006 missense unknown
R7823:Gm7579 UTSW 7 142212570 missense unknown
R8143:Gm7579 UTSW 7 142212426 nonsense probably null
R8341:Gm7579 UTSW 7 142212119 nonsense probably null
Z1176:Gm7579 UTSW 7 142211941 missense unknown
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-12-04