Incidental Mutation 'RF028:Dbr1'
ID604235
Institutional Source Beutler Lab
Gene Symbol Dbr1
Ensembl Gene ENSMUSG00000032469
Gene Namedebranching RNA lariats 1
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF028 (G1)
Quality Score217.468
Status Not validated
Chromosome9
Chromosomal Location99575799-99584501 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) GAGGAG to GAGGAGTAGGAG at 99583697 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000070991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066650] [ENSMUST00000139796] [ENSMUST00000148987]
Predicted Effect probably null
Transcript: ENSMUST00000066650
SMART Domains Protein: ENSMUSP00000070991
Gene: ENSMUSG00000032469

DomainStartEndE-ValueType
Pfam:Metallophos 1 230 1.8e-11 PFAM
DBR1 235 380 8.27e-85 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136884
SMART Domains Protein: ENSMUSP00000114670
Gene: ENSMUSG00000032469

DomainStartEndE-ValueType
DBR1 20 128 4.22e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138002
SMART Domains Protein: ENSMUSP00000119924
Gene: ENSMUSG00000032469

DomainStartEndE-ValueType
Pfam:Metallophos 2 144 5.5e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139796
SMART Domains Protein: ENSMUSP00000115203
Gene: ENSMUSG00000032469

DomainStartEndE-ValueType
Pfam:DBR1 52 82 1.8e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148987
SMART Domains Protein: ENSMUSP00000115074
Gene: ENSMUSG00000032469

DomainStartEndE-ValueType
DBR1 162 231 1.34e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156035
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an RNA lariat debranching enzyme that hydrolyzes 2'-5' prime branched phosphodiester bonds. The encoded protein specifically targets the bonds at the branch point of excised lariat intron RNA, converting them to linear molecules that are then degraded. This protein may also be involved in retroviral replication. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit prenatal lethality. Mice heterozygous for this allele exhibit impaired class switch recombination in B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik GCTGTG GCTGTGCCTCCTGTG 1: 82,913,578 probably benign Het
A030005L19Rik TGTGGCTGC TGTGGCTGCCGTGGCTGC 1: 82,913,580 probably benign Het
Acap3 TGCATCCTGGGCTGC TGCATCCTGGGCTGCAGCATCCTGGGCTGC 4: 155,905,091 probably benign Het
Arid1b C CGGG 17: 4,995,598 probably benign Het
Blm CCTCCTCCTCCTCCTCCTCCTCCT CCTCCTCCTCCTACTCCTCCTCCTCCTCCTCCTCCT 7: 80,512,905 probably null Het
Boc GAC G 16: 44,496,433 probably null Het
Cacna1f GAG GAGAAG X: 7,620,060 probably benign Het
Cacna1f GAG GAGAAG X: 7,620,063 probably benign Het
Catsper2 ATCGCTTTCCTCGTTTTCG ATCG 2: 121,397,726 probably benign Het
E4f1 CGC CGCGGC 17: 24,455,190 probably benign Het
Eps8 TCGCTC TCGCTCGCTC 6: 137,517,063 probably benign Het
Ermn AACT AACTACT 2: 58,048,066 probably benign Het
Fsip2 TAGATGTGAAACCCTTAGAGGTAAGATGTGAAACTCTTAGAGGTAAGA TAGATGTGAAACTCTTAGAGGTAAGA 2: 82,994,008 probably null Het
Gab3 CTTCTT CTTATTCTT X: 75,000,000 probably null Het
Gab3 TCT TCTGCT X: 75,000,017 probably benign Het
Gabre CTC CTCTGGGTC X: 72,270,763 probably benign Het
Gm7579 GGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGATGCAAGGGAGGCTGTGGCTCCTGTGGGGG GGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGATGCAAGGGAGGCTGTGGCTCCTGTGGGGG 7: 142,212,045 probably benign Het
Gm8369 TG TGGGTGAG 19: 11,511,773 probably null Het
Hsdl2 CAGCTGCAG CAGCTGCAGCAGCAGCCATAGCTGCAG 4: 59,610,650 probably null Het
Iqcf4 TTTTCCTTTT TTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCGTTTCCTTTT 9: 106,570,614 probably benign Het
Kmt2e TTT TTTTATT 5: 23,478,509 probably benign Het
Kri1 CTCCTCCT C 9: 21,281,071 probably null Het
Krtap28-10 AGCCACAGCCACCACAGCCACAGCCACCAC AGCCACAGCCACCACCGCCACAGCCACCACAGCCACAGCCACCAC 1: 83,042,258 probably benign Het
Lce1m GTTGCTGCCACTG GTTGCTGCCACTGTTGCTGCCACTG 3: 93,018,131 probably benign Het
Lor CGCCGCCT C 3: 92,081,899 probably null Het
Luzp1 A AGGTGGCCTCTTCAGG 4: 136,543,196 probably benign Het
Lypd8 CCAACA CCAACAGGTCCCTCGCCTCTGTTACCCCACAAATAAACAACA 11: 58,390,239 probably benign Het
Mn1 CAG CAGGAG 5: 111,419,711 probably benign Het
Nefh GGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGACTTGGCCTCACCTGTGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,012 probably benign Het
Nefh GGGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGGACTTGGCCTCACCTTGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,029 probably benign Het
Nf2 AAAAG A 11: 4,829,936 probably null Het
Nusap1 AGAT AGATCCACGTTAGCAGTGAGGAGCAAGCTGCGAT 2: 119,627,578 probably benign Het
Nusap1 CAGTGAGGAGCAAGCTGAGA CAGTGAGGAGCAAGCTGAGATACACGTTAGTAGTGAGGAGCAAGCTGAGA 2: 119,627,591 probably benign Het
Phf20 CCCCCC CCCCCCGCCCCC 2: 156,304,623 probably benign Het
Ppp1r8 TCTCTCTCAC TC 4: 132,830,615 probably benign Het
Prr5l GCCTC G 2: 101,797,573 probably null Het
Rbm12 CGGGACCGGGCATTGCGGGACCGGGCATTGCGGG CGG 2: 156,096,130 probably null Het
Rpgrip1 GA GAGTA 14: 52,149,398 probably null Het
Tanc1 GTGAGCAGAAACCAGCATTTAGAGGGAACCGGTCCCTTCACTGCAGGAA G 2: 59,843,269 probably benign Het
Tfeb GCA GCATCA 17: 47,786,097 probably benign Het
Tgoln1 T TTGTCTTGTCAGAATCACCTCCTGG 6: 72,616,036 probably benign Het
Thegl AGCGATCCTCCCCAGTCCCGCAAGGCC AGCGATCCTCCCCAGTCCCGCAAGGCCCGCGATCCTCCCCAGTCCCGCAAGGCC 5: 77,016,401 probably benign Het
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Trappc9 GCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT GCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT 15: 72,801,290 probably benign Het
Triobp CAGGACT CAGGACTGCCTGTGCCCAACGGAACAACCCAAGGACT 15: 78,967,039 probably benign Het
Zfhx3 AACAGCAGC AACAGCAGCTACAGCAGC 8: 108,956,096 probably benign Het
Zfp933 TT TTTGCCT 4: 147,825,731 probably null Het
Other mutations in Dbr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01642:Dbr1 APN 9 99575978 missense probably damaging 1.00
IGL01952:Dbr1 APN 9 99582412 missense possibly damaging 0.64
IGL01995:Dbr1 APN 9 99583899 missense probably benign 0.00
FR4340:Dbr1 UTSW 9 99583701 unclassified probably benign
FR4342:Dbr1 UTSW 9 99583680 unclassified probably benign
FR4449:Dbr1 UTSW 9 99583674 unclassified probably benign
FR4449:Dbr1 UTSW 9 99583686 unclassified probably benign
FR4449:Dbr1 UTSW 9 99583696 unclassified probably benign
FR4548:Dbr1 UTSW 9 99583673 nonsense probably null
FR4589:Dbr1 UTSW 9 99583677 unclassified probably benign
FR4589:Dbr1 UTSW 9 99583680 unclassified probably benign
FR4589:Dbr1 UTSW 9 99583683 unclassified probably benign
FR4589:Dbr1 UTSW 9 99583696 unclassified probably benign
FR4737:Dbr1 UTSW 9 99583686 unclassified probably benign
FR4737:Dbr1 UTSW 9 99583699 unclassified probably benign
FR4976:Dbr1 UTSW 9 99583689 unclassified probably benign
FR4976:Dbr1 UTSW 9 99583692 unclassified probably benign
FR4976:Dbr1 UTSW 9 99583701 unclassified probably benign
FR4976:Dbr1 UTSW 9 99583702 unclassified probably benign
PIT4131001:Dbr1 UTSW 9 99584019 splice site probably null
R0100:Dbr1 UTSW 9 99583669 missense probably benign 0.01
R1240:Dbr1 UTSW 9 99584020 missense probably benign 0.44
R1502:Dbr1 UTSW 9 99582387 missense probably damaging 1.00
R2265:Dbr1 UTSW 9 99579410 missense probably damaging 1.00
R2279:Dbr1 UTSW 9 99580147 missense probably benign 0.06
R5202:Dbr1 UTSW 9 99583891 missense probably benign 0.00
R7012:Dbr1 UTSW 9 99583321 nonsense probably null
R7025:Dbr1 UTSW 9 99575983 missense probably damaging 1.00
R7037:Dbr1 UTSW 9 99576568 splice site probably null
R7192:Dbr1 UTSW 9 99576702 critical splice donor site probably null
R7350:Dbr1 UTSW 9 99582549 missense
R7396:Dbr1 UTSW 9 99583390 missense probably damaging 1.00
R7601:Dbr1 UTSW 9 99582602 nonsense probably null
R7659:Dbr1 UTSW 9 99576610 missense probably damaging 1.00
RF033:Dbr1 UTSW 9 99583697 nonsense probably null
RF038:Dbr1 UTSW 9 99583697 unclassified probably benign
RF040:Dbr1 UTSW 9 99583697 nonsense probably null
RF043:Dbr1 UTSW 9 99583697 unclassified probably benign
RF045:Dbr1 UTSW 9 99583671 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ATGTCATGATTCAGAAGGCCAG -3'
(R):5'- TCAGCCGCTTCAGAGGAAAC -3'

Sequencing Primer
(F):5'- CCAGAGAGGAAGAGCACCATC -3'
(R):5'- GCCGCTTCAGAGGAAACTTAGC -3'
Posted On2019-12-04