Incidental Mutation 'RF028:Iqcf4'
ID604236
Institutional Source Beutler Lab
Gene Symbol Iqcf4
Ensembl Gene ENSMUSG00000041009
Gene NameIQ motif containing F4
Synonyms1700042N06Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.048) question?
Stock #RF028 (G1)
Quality Score161.468
Status Not validated
Chromosome9
Chromosomal Location106568319-106570996 bp(-) (GRCm38)
Type of Mutationsmall insertion (12 aa in frame mutation)
DNA Base Change (assembly) TTTTCCTTTT to TTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCGTTTCCTTTT at 106570614 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000082192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085111]
Predicted Effect probably benign
Transcript: ENSMUST00000085111
SMART Domains Protein: ENSMUSP00000082192
Gene: ENSMUSG00000041009

DomainStartEndE-ValueType
coiled coil region 14 41 N/A INTRINSIC
IQ 66 88 2.72e-3 SMART
IQ 89 111 2.32e2 SMART
IQ 122 144 9.33e-2 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik GCTGTG GCTGTGCCTCCTGTG 1: 82,913,578 probably benign Het
A030005L19Rik TGTGGCTGC TGTGGCTGCCGTGGCTGC 1: 82,913,580 probably benign Het
Acap3 TGCATCCTGGGCTGC TGCATCCTGGGCTGCAGCATCCTGGGCTGC 4: 155,905,091 probably benign Het
Arid1b C CGGG 17: 4,995,598 probably benign Het
Blm CCTCCTCCTCCTCCTCCTCCTCCT CCTCCTCCTCCTACTCCTCCTCCTCCTCCTCCTCCT 7: 80,512,905 probably null Het
Boc GAC G 16: 44,496,433 probably null Het
Cacna1f GAG GAGAAG X: 7,620,060 probably benign Het
Cacna1f GAG GAGAAG X: 7,620,063 probably benign Het
Catsper2 ATCGCTTTCCTCGTTTTCG ATCG 2: 121,397,726 probably benign Het
Dbr1 GAGGAG GAGGAGTAGGAG 9: 99,583,697 probably null Het
E4f1 CGC CGCGGC 17: 24,455,190 probably benign Het
Eps8 TCGCTC TCGCTCGCTC 6: 137,517,063 probably benign Het
Ermn AACT AACTACT 2: 58,048,066 probably benign Het
Fsip2 TAGATGTGAAACCCTTAGAGGTAAGATGTGAAACTCTTAGAGGTAAGA TAGATGTGAAACTCTTAGAGGTAAGA 2: 82,994,008 probably null Het
Gab3 CTTCTT CTTATTCTT X: 75,000,000 probably null Het
Gab3 TCT TCTGCT X: 75,000,017 probably benign Het
Gabre CTC CTCTGGGTC X: 72,270,763 probably benign Het
Gm7579 GGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGATGCAAGGGAGGCTGTGGCTCCTGTGGGGG GGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGATGCAAGGGAGGCTGTGGCTCCTGTGGGGG 7: 142,212,045 probably benign Het
Gm8369 TG TGGGTGAG 19: 11,511,773 probably null Het
Hsdl2 CAGCTGCAG CAGCTGCAGCAGCAGCCATAGCTGCAG 4: 59,610,650 probably null Het
Kmt2e TTT TTTTATT 5: 23,478,509 probably benign Het
Kri1 CTCCTCCT C 9: 21,281,071 probably null Het
Krtap28-10 AGCCACAGCCACCACAGCCACAGCCACCAC AGCCACAGCCACCACCGCCACAGCCACCACAGCCACAGCCACCAC 1: 83,042,258 probably benign Het
Lce1m GTTGCTGCCACTG GTTGCTGCCACTGTTGCTGCCACTG 3: 93,018,131 probably benign Het
Lor CGCCGCCT C 3: 92,081,899 probably null Het
Luzp1 A AGGTGGCCTCTTCAGG 4: 136,543,196 probably benign Het
Lypd8 CCAACA CCAACAGGTCCCTCGCCTCTGTTACCCCACAAATAAACAACA 11: 58,390,239 probably benign Het
Mn1 CAG CAGGAG 5: 111,419,711 probably benign Het
Nefh GGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGACTTGGCCTCACCTGTGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,012 probably benign Het
Nefh GGGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGGACTTGGCCTCACCTTGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,029 probably benign Het
Nf2 AAAAG A 11: 4,829,936 probably null Het
Nusap1 AGAT AGATCCACGTTAGCAGTGAGGAGCAAGCTGCGAT 2: 119,627,578 probably benign Het
Nusap1 CAGTGAGGAGCAAGCTGAGA CAGTGAGGAGCAAGCTGAGATACACGTTAGTAGTGAGGAGCAAGCTGAGA 2: 119,627,591 probably benign Het
Phf20 CCCCCC CCCCCCGCCCCC 2: 156,304,623 probably benign Het
Ppp1r8 TCTCTCTCAC TC 4: 132,830,615 probably benign Het
Prr5l GCCTC G 2: 101,797,573 probably null Het
Rbm12 CGGGACCGGGCATTGCGGGACCGGGCATTGCGGG CGG 2: 156,096,130 probably null Het
Rpgrip1 GA GAGTA 14: 52,149,398 probably null Het
Tanc1 GTGAGCAGAAACCAGCATTTAGAGGGAACCGGTCCCTTCACTGCAGGAA G 2: 59,843,269 probably benign Het
Tfeb GCA GCATCA 17: 47,786,097 probably benign Het
Tgoln1 T TTGTCTTGTCAGAATCACCTCCTGG 6: 72,616,036 probably benign Het
Thegl AGCGATCCTCCCCAGTCCCGCAAGGCC AGCGATCCTCCCCAGTCCCGCAAGGCCCGCGATCCTCCCCAGTCCCGCAAGGCC 5: 77,016,401 probably benign Het
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Trappc9 GCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT GCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT 15: 72,801,290 probably benign Het
Triobp CAGGACT CAGGACTGCCTGTGCCCAACGGAACAACCCAAGGACT 15: 78,967,039 probably benign Het
Zfhx3 AACAGCAGC AACAGCAGCTACAGCAGC 8: 108,956,096 probably benign Het
Zfp933 TT TTTGCCT 4: 147,825,731 probably null Het
Other mutations in Iqcf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Iqcf4 APN 9 106570633 missense probably benign 0.12
R0781:Iqcf4 UTSW 9 106568661 missense probably benign 0.06
R1764:Iqcf4 UTSW 9 106568694 missense probably benign 0.12
R4525:Iqcf4 UTSW 9 106570628 missense possibly damaging 0.51
R4703:Iqcf4 UTSW 9 106568320 splice site probably null
R5823:Iqcf4 UTSW 9 106568601 missense probably benign 0.00
R6298:Iqcf4 UTSW 9 106568675 missense probably benign 0.25
R7773:Iqcf4 UTSW 9 106568613 missense probably benign 0.08
R7780:Iqcf4 UTSW 9 106568661 missense possibly damaging 0.93
R7818:Iqcf4 UTSW 9 106570539 nonsense probably null
RF003:Iqcf4 UTSW 9 106570607 small insertion probably benign
RF007:Iqcf4 UTSW 9 106570609 small insertion probably benign
RF016:Iqcf4 UTSW 9 106570609 small insertion probably benign
RF031:Iqcf4 UTSW 9 106570615 small insertion probably benign
RF036:Iqcf4 UTSW 9 106570611 small insertion probably benign
RF041:Iqcf4 UTSW 9 106570613 nonsense probably null
RF042:Iqcf4 UTSW 9 106570605 small insertion probably benign
RF043:Iqcf4 UTSW 9 106570613 small insertion probably benign
RF045:Iqcf4 UTSW 9 106570610 small insertion probably benign
RF046:Iqcf4 UTSW 9 106570610 small insertion probably benign
RF047:Iqcf4 UTSW 9 106570612 small insertion probably benign
RF063:Iqcf4 UTSW 9 106570617 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- GTGACAGCAACCCAACCTCTTG -3'
(R):5'- ATCTAGGGATACTGGGCCAC -3'

Sequencing Primer
(F):5'- CACACAAGTCTGTTTGGTGCATAC -3'
(R):5'- ATACTGGGCCACTGTGGAGAC -3'
Posted On2019-12-04