Incidental Mutation 'RF028:Lypd8'
ID604240
Institutional Source Beutler Lab
Gene Symbol Lypd8
Ensembl Gene ENSMUSG00000013643
Gene NameLY6/PLAUR domain containing 8
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #RF028 (G1)
Quality Score217.468
Status Not validated
Chromosome11
Chromosomal Location58379043-58390728 bp(+) (GRCm38)
Type of Mutationsmall insertion (12 aa in frame mutation)
DNA Base Change (assembly) CCAACA to CCAACAGGTCCCTCGCCTCTGTTACCCCACAAATAAACAACA at 58390239 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013787] [ENSMUST00000108826]
Predicted Effect probably benign
Transcript: ENSMUST00000013787
SMART Domains Protein: ENSMUSP00000013787
Gene: ENSMUSG00000013643

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:UPAR_LY6 23 105 3.4e-5 PFAM
Pfam:UPAR_LY6 121 197 2.3e-5 PFAM
low complexity region 199 212 N/A INTRINSIC
low complexity region 248 254 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108826
SMART Domains Protein: ENSMUSP00000104454
Gene: ENSMUSG00000013643

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:UPAR_LY6 23 105 1.9e-4 PFAM
Pfam:UPAR_LY6 121 197 4.9e-5 PFAM
low complexity region 199 212 N/A INTRINSIC
low complexity region 248 254 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the Ly6/PLAUR family of cysteine-rich proteins that plays an important role in the protection of colonic epithelium from flagellated microbiota. The encoded protein undergoes proteolytic processing to generate a mature, glycosylphosphatidylinositol-anchored protein that is localized to the apical surface of the colonic epithelial cells. Mice lacking the encoded protein are sensitive to chemically induced intestinal inflammation. [provided by RefSeq, Aug 2016]
PHENOTYPE: No notable phenotype was detected in a high throughput screen of homozygous mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik GCTGTG GCTGTGCCTCCTGTG 1: 82,913,578 probably benign Het
A030005L19Rik TGTGGCTGC TGTGGCTGCCGTGGCTGC 1: 82,913,580 probably benign Het
Acap3 TGCATCCTGGGCTGC TGCATCCTGGGCTGCAGCATCCTGGGCTGC 4: 155,905,091 probably benign Het
Arid1b C CGGG 17: 4,995,598 probably benign Het
Blm CCTCCTCCTCCTCCTCCTCCTCCT CCTCCTCCTCCTACTCCTCCTCCTCCTCCTCCTCCT 7: 80,512,905 probably null Het
Boc GAC G 16: 44,496,433 probably null Het
Cacna1f GAG GAGAAG X: 7,620,060 probably benign Het
Cacna1f GAG GAGAAG X: 7,620,063 probably benign Het
Catsper2 ATCGCTTTCCTCGTTTTCG ATCG 2: 121,397,726 probably benign Het
Dbr1 GAGGAG GAGGAGTAGGAG 9: 99,583,697 probably null Het
E4f1 CGC CGCGGC 17: 24,455,190 probably benign Het
Eps8 TCGCTC TCGCTCGCTC 6: 137,517,063 probably benign Het
Ermn AACT AACTACT 2: 58,048,066 probably benign Het
Fsip2 TAGATGTGAAACCCTTAGAGGTAAGATGTGAAACTCTTAGAGGTAAGA TAGATGTGAAACTCTTAGAGGTAAGA 2: 82,994,008 probably null Het
Gab3 CTTCTT CTTATTCTT X: 75,000,000 probably null Het
Gab3 TCT TCTGCT X: 75,000,017 probably benign Het
Gabre CTC CTCTGGGTC X: 72,270,763 probably benign Het
Gm7579 GGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGATGCAAGGGAGGCTGTGGCTCCTGTGGGGG GGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGATGCAAGGGAGGCTGTGGCTCCTGTGGGGG 7: 142,212,045 probably benign Het
Gm8369 TG TGGGTGAG 19: 11,511,773 probably null Het
Hsdl2 CAGCTGCAG CAGCTGCAGCAGCAGCCATAGCTGCAG 4: 59,610,650 probably null Het
Iqcf4 TTTTCCTTTT TTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCGTTTCCTTTT 9: 106,570,614 probably benign Het
Kmt2e TTT TTTTATT 5: 23,478,509 probably benign Het
Kri1 CTCCTCCT C 9: 21,281,071 probably null Het
Krtap28-10 AGCCACAGCCACCACAGCCACAGCCACCAC AGCCACAGCCACCACCGCCACAGCCACCACAGCCACAGCCACCAC 1: 83,042,258 probably benign Het
Lce1m GTTGCTGCCACTG GTTGCTGCCACTGTTGCTGCCACTG 3: 93,018,131 probably benign Het
Lor CGCCGCCT C 3: 92,081,899 probably null Het
Luzp1 A AGGTGGCCTCTTCAGG 4: 136,543,196 probably benign Het
Mn1 CAG CAGGAG 5: 111,419,711 probably benign Het
Nefh GGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGACTTGGCCTCACCTGTGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,012 probably benign Het
Nefh GGGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGGACTTGGCCTCACCTTGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,029 probably benign Het
Nf2 AAAAG A 11: 4,829,936 probably null Het
Nusap1 AGAT AGATCCACGTTAGCAGTGAGGAGCAAGCTGCGAT 2: 119,627,578 probably benign Het
Nusap1 CAGTGAGGAGCAAGCTGAGA CAGTGAGGAGCAAGCTGAGATACACGTTAGTAGTGAGGAGCAAGCTGAGA 2: 119,627,591 probably benign Het
Phf20 CCCCCC CCCCCCGCCCCC 2: 156,304,623 probably benign Het
Ppp1r8 TCTCTCTCAC TC 4: 132,830,615 probably benign Het
Prr5l GCCTC G 2: 101,797,573 probably null Het
Rbm12 CGGGACCGGGCATTGCGGGACCGGGCATTGCGGG CGG 2: 156,096,130 probably null Het
Rpgrip1 GA GAGTA 14: 52,149,398 probably null Het
Tanc1 GTGAGCAGAAACCAGCATTTAGAGGGAACCGGTCCCTTCACTGCAGGAA G 2: 59,843,269 probably benign Het
Tfeb GCA GCATCA 17: 47,786,097 probably benign Het
Tgoln1 T TTGTCTTGTCAGAATCACCTCCTGG 6: 72,616,036 probably benign Het
Thegl AGCGATCCTCCCCAGTCCCGCAAGGCC AGCGATCCTCCCCAGTCCCGCAAGGCCCGCGATCCTCCCCAGTCCCGCAAGGCC 5: 77,016,401 probably benign Het
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Trappc9 GCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT GCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT 15: 72,801,290 probably benign Het
Triobp CAGGACT CAGGACTGCCTGTGCCCAACGGAACAACCCAAGGACT 15: 78,967,039 probably benign Het
Zfhx3 AACAGCAGC AACAGCAGCTACAGCAGC 8: 108,956,096 probably benign Het
Zfp933 TT TTTGCCT 4: 147,825,731 probably null Het
Other mutations in Lypd8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01895:Lypd8 APN 11 58390220 missense possibly damaging 0.53
confusion UTSW 11 58386757 missense probably benign 0.00
quandary UTSW 11 58384613 missense probably damaging 1.00
R0096:Lypd8 UTSW 11 58386757 missense probably benign 0.00
R0628:Lypd8 UTSW 11 58384673 missense probably damaging 1.00
R0711:Lypd8 UTSW 11 58386757 missense probably benign 0.00
R2294:Lypd8 UTSW 11 58386854 missense probably damaging 0.99
R3033:Lypd8 UTSW 11 58384627 missense probably damaging 0.99
R4562:Lypd8 UTSW 11 58382389 critical splice donor site probably null
R4610:Lypd8 UTSW 11 58386849 missense probably benign 0.00
R5224:Lypd8 UTSW 11 58386808 missense possibly damaging 0.93
R5468:Lypd8 UTSW 11 58386760 missense probably damaging 0.96
R6213:Lypd8 UTSW 11 58390334 missense probably benign
R6228:Lypd8 UTSW 11 58386803 missense possibly damaging 0.60
R6528:Lypd8 UTSW 11 58384613 missense probably damaging 1.00
R6947:Lypd8 UTSW 11 58382766 missense probably benign 0.00
R7811:Lypd8 UTSW 11 58390238 missense possibly damaging 0.53
RF018:Lypd8 UTSW 11 58390232 small insertion probably benign
RF039:Lypd8 UTSW 11 58390231 small insertion probably benign
RF042:Lypd8 UTSW 11 58390243 small insertion probably benign
RF043:Lypd8 UTSW 11 58390243 small insertion probably benign
RF054:Lypd8 UTSW 11 58390251 small insertion probably benign
RF057:Lypd8 UTSW 11 58390239 small insertion probably benign
Z1088:Lypd8 UTSW 11 58386730 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ACTTCTTCAGGCTCTGGCAG -3'
(R):5'- TTCCAACCCACTGGACAGTC -3'

Sequencing Primer
(F):5'- CTTCAGGCTCTGGCAGAGTGG -3'
(R):5'- TGTTGACACCCATGGGATAC -3'
Posted On2019-12-04