Incidental Mutation 'RF028:Rpgrip1'
ID604242
Institutional Source Beutler Lab
Gene Symbol Rpgrip1
Ensembl Gene ENSMUSG00000057132
Gene Nameretinitis pigmentosa GTPase regulator interacting protein 1
SynonymsA930002K18Rik, 4930505G06Rik, 4930401L23Rik, nmf247
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.259) question?
Stock #RF028 (G1)
Quality Score181.249
Status Not validated
Chromosome14
Chromosomal Location52110704-52163546 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) GA to GAGTA at 52149398 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111600] [ENSMUST00000111603] [ENSMUST00000180646] [ENSMUST00000181017] [ENSMUST00000181401]
Predicted Effect probably benign
Transcript: ENSMUST00000111600
SMART Domains Protein: ENSMUSP00000107227
Gene: ENSMUSG00000057132

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
coiled coil region 248 348 N/A INTRINSIC
coiled coil region 499 542 N/A INTRINSIC
C2 602 707 1.08e-2 SMART
coiled coil region 746 795 N/A INTRINSIC
Blast:C2 958 1086 1e-37 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000111603
SMART Domains Protein: ENSMUSP00000107230
Gene: ENSMUSG00000057132

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
coiled coil region 248 348 N/A INTRINSIC
coiled coil region 499 543 N/A INTRINSIC
Pfam:C2-C2_1 582 721 1.9e-49 PFAM
C2 764 869 7.3e-5 SMART
coiled coil region 910 999 N/A INTRINSIC
Blast:C2 1162 1290 2e-37 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000180500
Predicted Effect probably benign
Transcript: ENSMUST00000180513
Predicted Effect probably benign
Transcript: ENSMUST00000180646
SMART Domains Protein: ENSMUSP00000137751
Gene: ENSMUSG00000057132

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
coiled coil region 248 276 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000181017
SMART Domains Protein: ENSMUSP00000137900
Gene: ENSMUSG00000057132

DomainStartEndE-ValueType
coiled coil region 1 31 N/A INTRINSIC
Blast:C2 126 254 2e-41 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000181401
SMART Domains Protein: ENSMUSP00000138027
Gene: ENSMUSG00000057132

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
coiled coil region 248 348 N/A INTRINSIC
coiled coil region 499 547 N/A INTRINSIC
Pfam:DUF3250 605 710 2.8e-46 PFAM
C2 753 858 1.08e-2 SMART
coiled coil region 899 988 N/A INTRINSIC
Blast:C2 1151 1279 1e-37 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000181627
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a photoreceptor protein that interacts with retinitis pigmentosa GTPase regulator protein and is a key component of cone and rod photoreceptor cells. Mutations in this gene lead to autosomal recessive congenital blindness. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous mutation of this gene results in photoreceptor cell dysmorphology. By 3 months of age mutant animals show near complete loss of photoreceptor cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik GCTGTG GCTGTGCCTCCTGTG 1: 82,913,578 probably benign Het
A030005L19Rik TGTGGCTGC TGTGGCTGCCGTGGCTGC 1: 82,913,580 probably benign Het
Acap3 TGCATCCTGGGCTGC TGCATCCTGGGCTGCAGCATCCTGGGCTGC 4: 155,905,091 probably benign Het
Arid1b C CGGG 17: 4,995,598 probably benign Het
Blm CCTCCTCCTCCTCCTCCTCCTCCT CCTCCTCCTCCTACTCCTCCTCCTCCTCCTCCTCCT 7: 80,512,905 probably null Het
Boc GAC G 16: 44,496,433 probably null Het
Cacna1f GAG GAGAAG X: 7,620,060 probably benign Het
Cacna1f GAG GAGAAG X: 7,620,063 probably benign Het
Catsper2 ATCGCTTTCCTCGTTTTCG ATCG 2: 121,397,726 probably benign Het
Dbr1 GAGGAG GAGGAGTAGGAG 9: 99,583,697 probably null Het
E4f1 CGC CGCGGC 17: 24,455,190 probably benign Het
Eps8 TCGCTC TCGCTCGCTC 6: 137,517,063 probably benign Het
Ermn AACT AACTACT 2: 58,048,066 probably benign Het
Fsip2 TAGATGTGAAACCCTTAGAGGTAAGATGTGAAACTCTTAGAGGTAAGA TAGATGTGAAACTCTTAGAGGTAAGA 2: 82,994,008 probably null Het
Gab3 CTTCTT CTTATTCTT X: 75,000,000 probably null Het
Gab3 TCT TCTGCT X: 75,000,017 probably benign Het
Gabre CTC CTCTGGGTC X: 72,270,763 probably benign Het
Gm7579 GGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGATGCAAGGGAGGCTGTGGCTCCTGTGGGGG GGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGATGCAAGGGAGGCTGTGGCTCCTGTGGGGG 7: 142,212,045 probably benign Het
Gm8369 TG TGGGTGAG 19: 11,511,773 probably null Het
Hsdl2 CAGCTGCAG CAGCTGCAGCAGCAGCCATAGCTGCAG 4: 59,610,650 probably null Het
Iqcf4 TTTTCCTTTT TTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCGTTTCCTTTT 9: 106,570,614 probably benign Het
Kmt2e TTT TTTTATT 5: 23,478,509 probably benign Het
Kri1 CTCCTCCT C 9: 21,281,071 probably null Het
Krtap28-10 AGCCACAGCCACCACAGCCACAGCCACCAC AGCCACAGCCACCACCGCCACAGCCACCACAGCCACAGCCACCAC 1: 83,042,258 probably benign Het
Lce1m GTTGCTGCCACTG GTTGCTGCCACTGTTGCTGCCACTG 3: 93,018,131 probably benign Het
Lor CGCCGCCT C 3: 92,081,899 probably null Het
Luzp1 A AGGTGGCCTCTTCAGG 4: 136,543,196 probably benign Het
Lypd8 CCAACA CCAACAGGTCCCTCGCCTCTGTTACCCCACAAATAAACAACA 11: 58,390,239 probably benign Het
Mn1 CAG CAGGAG 5: 111,419,711 probably benign Het
Nefh GGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGACTTGGCCTCACCTGTGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,012 probably benign Het
Nefh GGGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGGACTTGGCCTCACCTTGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,029 probably benign Het
Nf2 AAAAG A 11: 4,829,936 probably null Het
Nusap1 AGAT AGATCCACGTTAGCAGTGAGGAGCAAGCTGCGAT 2: 119,627,578 probably benign Het
Nusap1 CAGTGAGGAGCAAGCTGAGA CAGTGAGGAGCAAGCTGAGATACACGTTAGTAGTGAGGAGCAAGCTGAGA 2: 119,627,591 probably benign Het
Phf20 CCCCCC CCCCCCGCCCCC 2: 156,304,623 probably benign Het
Ppp1r8 TCTCTCTCAC TC 4: 132,830,615 probably benign Het
Prr5l GCCTC G 2: 101,797,573 probably null Het
Rbm12 CGGGACCGGGCATTGCGGGACCGGGCATTGCGGG CGG 2: 156,096,130 probably null Het
Tanc1 GTGAGCAGAAACCAGCATTTAGAGGGAACCGGTCCCTTCACTGCAGGAA G 2: 59,843,269 probably benign Het
Tfeb GCA GCATCA 17: 47,786,097 probably benign Het
Tgoln1 T TTGTCTTGTCAGAATCACCTCCTGG 6: 72,616,036 probably benign Het
Thegl AGCGATCCTCCCCAGTCCCGCAAGGCC AGCGATCCTCCCCAGTCCCGCAAGGCCCGCGATCCTCCCCAGTCCCGCAAGGCC 5: 77,016,401 probably benign Het
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Trappc9 GCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT GCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT 15: 72,801,290 probably benign Het
Triobp CAGGACT CAGGACTGCCTGTGCCCAACGGAACAACCCAAGGACT 15: 78,967,039 probably benign Het
Zfhx3 AACAGCAGC AACAGCAGCTACAGCAGC 8: 108,956,096 probably benign Het
Zfp933 TT TTTGCCT 4: 147,825,731 probably null Het
Other mutations in Rpgrip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Rpgrip1 APN 14 52150438 unclassified probably null
IGL01016:Rpgrip1 APN 14 52145836 missense probably damaging 1.00
IGL01019:Rpgrip1 APN 14 52131176 missense possibly damaging 0.70
IGL01382:Rpgrip1 APN 14 52145477 missense possibly damaging 0.93
IGL01433:Rpgrip1 APN 14 52126377 missense probably damaging 1.00
IGL01528:Rpgrip1 APN 14 52112177 nonsense probably null
IGL01548:Rpgrip1 APN 14 52126271 splice site probably benign
IGL01652:Rpgrip1 APN 14 52145492 unclassified probably benign
IGL02040:Rpgrip1 APN 14 52121019 missense possibly damaging 0.86
IGL02113:Rpgrip1 APN 14 52133844 missense possibly damaging 0.85
IGL02121:Rpgrip1 APN 14 52147374 missense possibly damaging 0.89
IGL02185:Rpgrip1 APN 14 52112228 missense possibly damaging 0.72
IGL02234:Rpgrip1 APN 14 52131309 splice site probably benign
IGL02322:Rpgrip1 APN 14 52150042 missense possibly damaging 0.89
IGL02379:Rpgrip1 APN 14 52138888 missense possibly damaging 0.53
IGL02524:Rpgrip1 APN 14 52121054 missense probably benign 0.01
IGL02836:Rpgrip1 APN 14 52145257 unclassified probably null
IGL03264:Rpgrip1 APN 14 52140652 missense possibly damaging 0.53
IGL03410:Rpgrip1 APN 14 52158366 unclassified probably benign
FR4976:Rpgrip1 UTSW 14 52149394 utr 3 prime probably benign
FR4976:Rpgrip1 UTSW 14 52149544 utr 3 prime probably benign
R0045:Rpgrip1 UTSW 14 52141144 missense possibly damaging 0.53
R0045:Rpgrip1 UTSW 14 52141144 missense possibly damaging 0.53
R0089:Rpgrip1 UTSW 14 52149384 utr 3 prime probably benign
R0498:Rpgrip1 UTSW 14 52131314 splice site probably benign
R0602:Rpgrip1 UTSW 14 52133856 missense possibly damaging 0.72
R0776:Rpgrip1 UTSW 14 52141169 missense possibly damaging 0.85
R1139:Rpgrip1 UTSW 14 52147221 missense probably benign 0.33
R1528:Rpgrip1 UTSW 14 52112224 missense probably benign 0.01
R1715:Rpgrip1 UTSW 14 52140691 missense possibly damaging 0.53
R1934:Rpgrip1 UTSW 14 52114644 missense possibly damaging 0.53
R2087:Rpgrip1 UTSW 14 52136622 intron probably null
R2114:Rpgrip1 UTSW 14 52149567 missense probably benign 0.27
R3406:Rpgrip1 UTSW 14 52145209 missense possibly damaging 0.92
R3835:Rpgrip1 UTSW 14 52147253 missense probably damaging 1.00
R4084:Rpgrip1 UTSW 14 52149351 missense possibly damaging 0.72
R4124:Rpgrip1 UTSW 14 52152324 splice site probably null
R4381:Rpgrip1 UTSW 14 52150449 missense possibly damaging 0.54
R4407:Rpgrip1 UTSW 14 52147399 missense probably damaging 1.00
R4520:Rpgrip1 UTSW 14 52152289 missense probably benign 0.08
R4904:Rpgrip1 UTSW 14 52121087 missense possibly damaging 0.86
R4904:Rpgrip1 UTSW 14 52160129 missense probably damaging 0.97
R5284:Rpgrip1 UTSW 14 52149276 missense probably damaging 1.00
R5342:Rpgrip1 UTSW 14 52145209 missense possibly damaging 0.92
R5377:Rpgrip1 UTSW 14 52160195 missense possibly damaging 0.96
R5499:Rpgrip1 UTSW 14 52140585 missense probably benign 0.00
R5729:Rpgrip1 UTSW 14 52160160 missense probably benign 0.28
R5834:Rpgrip1 UTSW 14 52158382 missense probably damaging 0.99
R6157:Rpgrip1 UTSW 14 52112174 missense probably benign 0.00
R6455:Rpgrip1 UTSW 14 52141189 missense probably damaging 0.97
R6796:Rpgrip1 UTSW 14 52150012 missense probably damaging 1.00
R7065:Rpgrip1 UTSW 14 52141193 missense possibly damaging 0.96
R7173:Rpgrip1 UTSW 14 52112176 missense possibly damaging 0.59
R7302:Rpgrip1 UTSW 14 52149555 missense unknown
R7315:Rpgrip1 UTSW 14 52121001 missense not run
R7320:Rpgrip1 UTSW 14 52131216 missense possibly damaging 0.53
R7344:Rpgrip1 UTSW 14 52140659 missense probably damaging 0.98
R7459:Rpgrip1 UTSW 14 52140559 missense probably benign 0.18
R7797:Rpgrip1 UTSW 14 52133820 missense possibly damaging 0.53
R7852:Rpgrip1 UTSW 14 52145880 missense probably benign 0.01
R7935:Rpgrip1 UTSW 14 52145880 missense probably benign 0.01
R8041:Rpgrip1 UTSW 14 52119245 missense possibly damaging 0.53
RF034:Rpgrip1 UTSW 14 52149526 utr 3 prime probably benign
RF035:Rpgrip1 UTSW 14 52149393 utr 3 prime probably benign
RF036:Rpgrip1 UTSW 14 52149541 frame shift probably null
RF040:Rpgrip1 UTSW 14 52149537 frame shift probably null
RF043:Rpgrip1 UTSW 14 52149395 utr 3 prime probably benign
X0024:Rpgrip1 UTSW 14 52141208 missense possibly damaging 0.85
X0026:Rpgrip1 UTSW 14 52147221 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- CTCAGGTGATTTCAATCTCACAGAC -3'
(R):5'- TTCTTCCGTGAATGAGGCCTC -3'

Sequencing Primer
(F):5'- TTCAATCTCACAGACTCTGGGGAG -3'
(R):5'- TGAATGAGGCCTCCAGGAC -3'
Posted On2019-12-04